Incidental Mutation 'R1629:Eaf2'
ID172697
Institutional Source Beutler Lab
Gene Symbol Eaf2
Ensembl Gene ENSMUSG00000022838
Gene NameELL associated factor 2
SynonymsTraits, FESTA-L, FESTA-S, U19, Festa
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock #R1629 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location36792884-36875003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36824701 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 53 (V53A)
Ref Sequence ENSEMBL: ENSMUSP00000023537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023535] [ENSMUST00000023537] [ENSMUST00000075946] [ENSMUST00000114819] [ENSMUST00000114829]
Predicted Effect probably benign
Transcript: ENSMUST00000023535
SMART Domains Protein: ENSMUSP00000023535
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000023537
AA Change: V53A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023537
Gene: ENSMUSG00000022838
AA Change: V53A

DomainStartEndE-ValueType
Pfam:EAF 14 116 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075946
SMART Domains Protein: ENSMUSP00000075331
Gene: ENSMUSG00000022838

DomainStartEndE-ValueType
low complexity region 44 71 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114819
SMART Domains Protein: ENSMUSP00000110467
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114829
AA Change: V53A

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110477
Gene: ENSMUSG00000022838
AA Change: V53A

DomainStartEndE-ValueType
Pfam:EAF 16 115 8.6e-24 PFAM
low complexity region 174 201 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232162
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit premature death, enlarged heart and prostate associate with hypertrophy, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Eaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Eaf2 APN 16 36800676 missense probably benign 0.28
IGL01394:Eaf2 APN 16 36810566 missense probably damaging 1.00
IGL03065:Eaf2 APN 16 36828122 missense probably benign 0.00
R0012:Eaf2 UTSW 16 36808174 splice site probably benign
R0036:Eaf2 UTSW 16 36800658 missense probably benign 0.01
R1779:Eaf2 UTSW 16 36810470 critical splice donor site probably null
R1816:Eaf2 UTSW 16 36808009 splice site probably benign
R1881:Eaf2 UTSW 16 36800579 splice site probably benign
R4376:Eaf2 UTSW 16 36800636 missense unknown
R7360:Eaf2 UTSW 16 36828152 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCAAACATAACAGCACAAGTGGAGAA -3'
(R):5'- GGATTGTACTCTTTAAACAGTGCCCCAA -3'

Sequencing Primer
(F):5'- CCTGTAATCACTTTCAAGTCATTGG -3'
(R):5'- caattaaggaagggacttgctac -3'
Posted On2014-04-24