Incidental Mutation 'R1629:Son'
ID 172698
Institutional Source Beutler Lab
Gene Symbol Son
Ensembl Gene ENSMUSG00000022961
Gene Name Son DNA binding protein
Synonyms 2900011L12Rik
MMRRC Submission 039666-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.955) question?
Stock # R1629 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 91444712-91476080 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91454510 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1086 (S1086P)
Ref Sequence ENSEMBL: ENSMUSP00000122320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]
AlphaFold Q9QX47
Predicted Effect possibly damaging
Transcript: ENSMUST00000114036
AA Change: S1086P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: S1086P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.65e-7 PROSPERO
internal_repeat_2 214 362 6.55e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.65e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.55e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114037
AA Change: S1086P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: S1086P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117633
AA Change: S1086P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: S1086P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119368
AA Change: S1086P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: S1086P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.22e-7 PROSPERO
internal_repeat_2 214 362 8.67e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.22e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 8.67e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140312
AA Change: S1086P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: S1086P

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147891
SMART Domains Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
Pfam:RSRP 61 358 2.9e-13 PFAM
low complexity region 466 477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 59,087,691 (GRCm39) I574L probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
BC005624 T C 2: 30,864,020 (GRCm39) E191G probably damaging Het
Cbx2 A G 11: 118,919,806 (GRCm39) D457G probably damaging Het
Ccdc110 A G 8: 46,395,164 (GRCm39) K352E probably benign Het
Cdk14 A T 5: 5,153,807 (GRCm39) H183Q probably benign Het
Cfap58 A G 19: 47,929,778 (GRCm39) T80A probably benign Het
Cftr C T 6: 18,226,105 (GRCm39) T351I probably damaging Het
Col27a1 A G 4: 63,248,100 (GRCm39) probably benign Het
Cp T A 3: 20,020,614 (GRCm39) probably null Het
Cpne8 A T 15: 90,456,175 (GRCm39) V196E probably benign Het
Dmxl1 T G 18: 49,992,353 (GRCm39) probably null Het
Dnm2 T A 9: 21,415,754 (GRCm39) L642Q probably damaging Het
Dock2 G T 11: 34,212,480 (GRCm39) probably null Het
Dock9 A G 14: 121,780,986 (GRCm39) F2091L possibly damaging Het
Eaf2 A G 16: 36,645,063 (GRCm39) V53A probably damaging Het
Fbl G T 7: 27,874,212 (GRCm39) probably benign Het
Fbn2 T C 18: 58,159,610 (GRCm39) D2373G probably damaging Het
Gbp2b A G 3: 142,316,735 (GRCm39) Y462C possibly damaging Het
Il1rl2 T A 1: 40,396,020 (GRCm39) F348I probably benign Het
Khdc1a T A 1: 21,421,121 (GRCm39) I102N possibly damaging Het
Klhl11 T C 11: 100,355,012 (GRCm39) T270A probably benign Het
Lama1 T C 17: 68,112,423 (GRCm39) S2288P probably benign Het
Lrfn4 T C 19: 4,663,523 (GRCm39) E337G possibly damaging Het
Macf1 C A 4: 123,402,208 (GRCm39) E549* probably null Het
Mmp3 G T 9: 7,447,641 (GRCm39) V209F probably benign Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myh9 G A 15: 77,648,601 (GRCm39) R1725W probably damaging Het
Nbea A T 3: 55,910,312 (GRCm39) D1294E possibly damaging Het
Nrcam G A 12: 44,610,769 (GRCm39) A496T probably benign Het
Nufip2 A G 11: 77,583,834 (GRCm39) T583A probably benign Het
Or5m3b A G 2: 85,871,766 (GRCm39) T36A probably damaging Het
Ppig C A 2: 69,566,217 (GRCm39) T128K probably damaging Het
Ppp2r2a A T 14: 67,257,208 (GRCm39) C341S possibly damaging Het
Ptpre A T 7: 135,271,528 (GRCm39) D374V probably damaging Het
Ranbp3l A C 15: 9,065,068 (GRCm39) Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,437,223 (GRCm39) probably null Het
Slc1a7 A G 4: 107,865,340 (GRCm39) Y276C probably damaging Het
Smarcad1 A G 6: 65,044,091 (GRCm39) D221G probably benign Het
Smn1 C A 13: 100,264,404 (GRCm39) T45N probably damaging Het
Ssmem1 T A 6: 30,512,491 (GRCm39) Y45N possibly damaging Het
Tasor2 T C 13: 3,624,121 (GRCm39) H1943R possibly damaging Het
Tmem184c A C 8: 78,329,551 (GRCm39) F170V possibly damaging Het
Tmem184c A T 8: 78,332,791 (GRCm39) probably null Het
Vmn1r59 C T 7: 5,457,466 (GRCm39) C98Y probably damaging Het
Vmn2r23 T A 6: 123,690,386 (GRCm39) S421T probably benign Het
Vmn2r98 T C 17: 19,287,645 (GRCm39) S493P possibly damaging Het
Other mutations in Son
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Son APN 16 91,461,210 (GRCm39) missense probably damaging 0.99
IGL01024:Son APN 16 91,452,798 (GRCm39) missense probably damaging 1.00
IGL01066:Son APN 16 91,457,024 (GRCm39) intron probably benign
IGL01083:Son APN 16 91,454,279 (GRCm39) missense probably damaging 1.00
IGL01115:Son APN 16 91,456,346 (GRCm39) missense probably benign 0.31
IGL01467:Son APN 16 91,454,165 (GRCm39) missense possibly damaging 0.93
IGL01506:Son APN 16 91,454,174 (GRCm39) missense possibly damaging 0.67
IGL01933:Son APN 16 91,454,903 (GRCm39) missense probably benign 0.00
IGL02156:Son APN 16 91,452,992 (GRCm39) missense possibly damaging 0.93
IGL02473:Son APN 16 91,455,683 (GRCm39) missense probably damaging 0.99
IGL02498:Son APN 16 91,453,713 (GRCm39) missense probably damaging 0.99
IGL02517:Son APN 16 91,452,099 (GRCm39) missense possibly damaging 0.92
IGL02530:Son APN 16 91,455,359 (GRCm39) missense possibly damaging 0.50
IGL02865:Son APN 16 91,448,640 (GRCm39) missense probably damaging 1.00
IGL03180:Son APN 16 91,453,896 (GRCm39) missense probably damaging 1.00
R0013:Son UTSW 16 91,448,550 (GRCm39) missense probably damaging 1.00
R0036:Son UTSW 16 91,457,054 (GRCm39) intron probably benign
R0037:Son UTSW 16 91,461,616 (GRCm39) missense probably damaging 1.00
R0041:Son UTSW 16 91,456,221 (GRCm39) missense probably damaging 1.00
R0048:Son UTSW 16 91,455,865 (GRCm39) missense possibly damaging 0.94
R0048:Son UTSW 16 91,455,865 (GRCm39) missense possibly damaging 0.94
R0056:Son UTSW 16 91,475,043 (GRCm39) missense possibly damaging 0.86
R0227:Son UTSW 16 91,453,761 (GRCm39) missense probably damaging 0.99
R0256:Son UTSW 16 91,453,472 (GRCm39) missense possibly damaging 0.95
R0302:Son UTSW 16 91,453,032 (GRCm39) missense probably damaging 1.00
R0815:Son UTSW 16 91,452,372 (GRCm39) missense probably damaging 0.98
R1225:Son UTSW 16 91,454,228 (GRCm39) missense probably damaging 1.00
R1255:Son UTSW 16 91,461,583 (GRCm39) missense probably damaging 1.00
R1457:Son UTSW 16 91,453,974 (GRCm39) missense probably damaging 1.00
R1459:Son UTSW 16 91,452,230 (GRCm39) missense possibly damaging 0.93
R1535:Son UTSW 16 91,456,622 (GRCm39) missense probably damaging 0.99
R1587:Son UTSW 16 91,456,606 (GRCm39) missense probably damaging 1.00
R1605:Son UTSW 16 91,454,552 (GRCm39) missense probably damaging 1.00
R1711:Son UTSW 16 91,457,114 (GRCm39) intron probably benign
R2138:Son UTSW 16 91,456,260 (GRCm39) missense possibly damaging 0.95
R2245:Son UTSW 16 91,444,848 (GRCm39) splice site probably null
R2351:Son UTSW 16 91,454,547 (GRCm39) missense probably damaging 0.98
R2434:Son UTSW 16 91,451,575 (GRCm39) missense probably damaging 1.00
R2870:Son UTSW 16 91,461,205 (GRCm39) splice site probably null
R2871:Son UTSW 16 91,461,205 (GRCm39) splice site probably null
R2872:Son UTSW 16 91,461,205 (GRCm39) splice site probably null
R2889:Son UTSW 16 91,456,787 (GRCm39) unclassified probably benign
R3712:Son UTSW 16 91,453,614 (GRCm39) missense probably damaging 0.99
R3913:Son UTSW 16 91,456,999 (GRCm39) intron probably benign
R4172:Son UTSW 16 91,456,250 (GRCm39) missense probably damaging 1.00
R4301:Son UTSW 16 91,455,299 (GRCm39) missense possibly damaging 0.53
R4302:Son UTSW 16 91,455,299 (GRCm39) missense possibly damaging 0.53
R4770:Son UTSW 16 91,455,756 (GRCm39) missense probably damaging 0.96
R4881:Son UTSW 16 91,472,397 (GRCm39) missense probably benign 0.31
R5020:Son UTSW 16 91,453,263 (GRCm39) missense probably damaging 1.00
R5032:Son UTSW 16 91,454,552 (GRCm39) missense probably damaging 1.00
R5151:Son UTSW 16 91,452,587 (GRCm39) missense probably damaging 1.00
R5153:Son UTSW 16 91,451,910 (GRCm39) missense possibly damaging 0.86
R5215:Son UTSW 16 91,453,563 (GRCm39) missense probably damaging 0.99
R5243:Son UTSW 16 91,451,621 (GRCm39) missense probably damaging 1.00
R5354:Son UTSW 16 91,452,627 (GRCm39) missense probably damaging 0.99
R5529:Son UTSW 16 91,452,354 (GRCm39) missense probably damaging 1.00
R5696:Son UTSW 16 91,468,301 (GRCm39) missense possibly damaging 0.67
R5763:Son UTSW 16 91,454,378 (GRCm39) missense probably damaging 1.00
R5766:Son UTSW 16 91,461,875 (GRCm39) intron probably benign
R5788:Son UTSW 16 91,456,940 (GRCm39) intron probably benign
R5992:Son UTSW 16 91,455,792 (GRCm39) missense probably benign 0.04
R6314:Son UTSW 16 91,457,298 (GRCm39) intron probably benign
R6371:Son UTSW 16 91,471,629 (GRCm39)
R6429:Son UTSW 16 91,455,054 (GRCm39) missense probably benign 0.33
R6451:Son UTSW 16 91,454,490 (GRCm39) missense probably damaging 0.99
R6489:Son UTSW 16 91,452,044 (GRCm39) missense possibly damaging 0.70
R6513:Son UTSW 16 91,456,835 (GRCm39) intron probably benign
R6753:Son UTSW 16 91,454,076 (GRCm39) missense probably damaging 0.99
R6916:Son UTSW 16 91,451,673 (GRCm39) missense probably damaging 0.97
R7070:Son UTSW 16 91,453,729 (GRCm39) unclassified probably benign
R7079:Son UTSW 16 91,453,729 (GRCm39) unclassified probably benign
R7110:Son UTSW 16 91,453,406 (GRCm39) missense probably benign 0.01
R7120:Son UTSW 16 91,467,414 (GRCm39) missense unknown
R7120:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R7167:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7205:Son UTSW 16 91,457,183 (GRCm39) small deletion probably benign
R7208:Son UTSW 16 91,458,990 (GRCm39) missense unknown
R7219:Son UTSW 16 91,461,889 (GRCm39) missense unknown
R7249:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7328:Son UTSW 16 91,455,278 (GRCm39) missense probably benign 0.33
R7330:Son UTSW 16 91,453,486 (GRCm39) unclassified probably benign
R7374:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7405:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R7420:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7424:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7464:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R7514:Son UTSW 16 91,451,748 (GRCm39) missense probably damaging 0.99
R7555:Son UTSW 16 91,455,810 (GRCm39) missense probably damaging 0.99
R7645:Son UTSW 16 91,457,183 (GRCm39) small deletion probably benign
R7716:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R7718:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7778:Son UTSW 16 91,453,416 (GRCm39) missense probably damaging 0.99
R7824:Son UTSW 16 91,453,416 (GRCm39) missense probably damaging 0.99
R7856:Son UTSW 16 91,456,146 (GRCm39) missense probably damaging 0.99
R7870:Son UTSW 16 91,453,486 (GRCm39) unclassified probably benign
R7928:Son UTSW 16 91,453,729 (GRCm39) unclassified probably benign
R7972:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7978:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8000:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8192:Son UTSW 16 91,452,437 (GRCm39) missense possibly damaging 0.91
R8221:Son UTSW 16 91,453,734 (GRCm39) missense probably damaging 1.00
R8227:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R8233:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8255:Son UTSW 16 91,461,824 (GRCm39) missense unknown
R8292:Son UTSW 16 91,453,545 (GRCm39) missense possibly damaging 0.93
R8407:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8468:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R8495:Son UTSW 16 91,457,183 (GRCm39) small deletion probably benign
R8772:Son UTSW 16 91,454,826 (GRCm39) missense possibly damaging 0.65
R8796:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8862:Son UTSW 16 91,453,734 (GRCm39) missense probably damaging 1.00
R8962:Son UTSW 16 91,455,057 (GRCm39) missense possibly damaging 0.91
R8972:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8991:Son UTSW 16 91,453,608 (GRCm39) missense possibly damaging 0.95
R8991:Son UTSW 16 91,453,366 (GRCm39) missense probably benign 0.04
R9086:Son UTSW 16 91,467,418 (GRCm39) missense unknown
R9138:Son UTSW 16 91,452,006 (GRCm39) missense possibly damaging 0.80
R9232:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R9241:Son UTSW 16 91,454,122 (GRCm39) missense probably damaging 0.96
R9258:Son UTSW 16 91,474,570 (GRCm39) missense unknown
R9328:Son UTSW 16 91,452,645 (GRCm39) missense possibly damaging 0.67
R9420:Son UTSW 16 91,454,508 (GRCm39) missense probably damaging 0.98
R9468:Son UTSW 16 91,454,439 (GRCm39) missense possibly damaging 0.53
R9500:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R9516:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R9595:Son UTSW 16 91,454,241 (GRCm39) missense possibly damaging 0.73
R9679:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R9719:Son UTSW 16 91,456,440 (GRCm39) missense probably damaging 0.96
R9749:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R9772:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R9782:Son UTSW 16 91,444,838 (GRCm39) missense probably damaging 0.99
R9788:Son UTSW 16 91,453,699 (GRCm39) unclassified probably benign
RF007:Son UTSW 16 91,456,257 (GRCm39) missense possibly damaging 0.53
RF041:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
Z1176:Son UTSW 16 91,452,689 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCCTATGGCTGAACGCTCTATGATG -3'
(R):5'- GCTCTGTTGATAATGCTGGACCCTC -3'

Sequencing Primer
(F):5'- CTCTATGATGTCGGCCTATGAGC -3'
(R):5'- CTCTTCAGGAGGCAAAGGTG -3'
Posted On 2014-04-24