Incidental Mutation 'R1629:Vmn2r98'
ID 172699
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission 039666-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R1629 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 19273755-19301573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19287645 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 493 (S493P)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect possibly damaging
Transcript: ENSMUST00000170424
AA Change: S493P

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: S493P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 59,087,691 (GRCm39) I574L probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
BC005624 T C 2: 30,864,020 (GRCm39) E191G probably damaging Het
Cbx2 A G 11: 118,919,806 (GRCm39) D457G probably damaging Het
Ccdc110 A G 8: 46,395,164 (GRCm39) K352E probably benign Het
Cdk14 A T 5: 5,153,807 (GRCm39) H183Q probably benign Het
Cfap58 A G 19: 47,929,778 (GRCm39) T80A probably benign Het
Cftr C T 6: 18,226,105 (GRCm39) T351I probably damaging Het
Col27a1 A G 4: 63,248,100 (GRCm39) probably benign Het
Cp T A 3: 20,020,614 (GRCm39) probably null Het
Cpne8 A T 15: 90,456,175 (GRCm39) V196E probably benign Het
Dmxl1 T G 18: 49,992,353 (GRCm39) probably null Het
Dnm2 T A 9: 21,415,754 (GRCm39) L642Q probably damaging Het
Dock2 G T 11: 34,212,480 (GRCm39) probably null Het
Dock9 A G 14: 121,780,986 (GRCm39) F2091L possibly damaging Het
Eaf2 A G 16: 36,645,063 (GRCm39) V53A probably damaging Het
Fbl G T 7: 27,874,212 (GRCm39) probably benign Het
Fbn2 T C 18: 58,159,610 (GRCm39) D2373G probably damaging Het
Gbp2b A G 3: 142,316,735 (GRCm39) Y462C possibly damaging Het
Il1rl2 T A 1: 40,396,020 (GRCm39) F348I probably benign Het
Khdc1a T A 1: 21,421,121 (GRCm39) I102N possibly damaging Het
Klhl11 T C 11: 100,355,012 (GRCm39) T270A probably benign Het
Lama1 T C 17: 68,112,423 (GRCm39) S2288P probably benign Het
Lrfn4 T C 19: 4,663,523 (GRCm39) E337G possibly damaging Het
Macf1 C A 4: 123,402,208 (GRCm39) E549* probably null Het
Mmp3 G T 9: 7,447,641 (GRCm39) V209F probably benign Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myh9 G A 15: 77,648,601 (GRCm39) R1725W probably damaging Het
Nbea A T 3: 55,910,312 (GRCm39) D1294E possibly damaging Het
Nrcam G A 12: 44,610,769 (GRCm39) A496T probably benign Het
Nufip2 A G 11: 77,583,834 (GRCm39) T583A probably benign Het
Or5m3b A G 2: 85,871,766 (GRCm39) T36A probably damaging Het
Ppig C A 2: 69,566,217 (GRCm39) T128K probably damaging Het
Ppp2r2a A T 14: 67,257,208 (GRCm39) C341S possibly damaging Het
Ptpre A T 7: 135,271,528 (GRCm39) D374V probably damaging Het
Ranbp3l A C 15: 9,065,068 (GRCm39) Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,437,223 (GRCm39) probably null Het
Slc1a7 A G 4: 107,865,340 (GRCm39) Y276C probably damaging Het
Smarcad1 A G 6: 65,044,091 (GRCm39) D221G probably benign Het
Smn1 C A 13: 100,264,404 (GRCm39) T45N probably damaging Het
Son T C 16: 91,454,510 (GRCm39) S1086P probably damaging Het
Ssmem1 T A 6: 30,512,491 (GRCm39) Y45N possibly damaging Het
Tasor2 T C 13: 3,624,121 (GRCm39) H1943R possibly damaging Het
Tmem184c A C 8: 78,329,551 (GRCm39) F170V possibly damaging Het
Tmem184c A T 8: 78,332,791 (GRCm39) probably null Het
Vmn1r59 C T 7: 5,457,466 (GRCm39) C98Y probably damaging Het
Vmn2r23 T A 6: 123,690,386 (GRCm39) S421T probably benign Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19,286,007 (GRCm39) splice site probably benign
IGL01296:Vmn2r98 APN 17 19,285,447 (GRCm39) missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19,286,020 (GRCm39) missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19,285,521 (GRCm39) missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19,286,713 (GRCm39) missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19,286,548 (GRCm39) missense probably benign
IGL02123:Vmn2r98 APN 17 19,300,941 (GRCm39) missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19,286,113 (GRCm39) missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19,286,083 (GRCm39) missense probably benign
IGL02650:Vmn2r98 APN 17 19,301,223 (GRCm39) missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19,285,521 (GRCm39) missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19,286,275 (GRCm39) missense probably benign
IGL02807:Vmn2r98 APN 17 19,301,283 (GRCm39) missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19,286,242 (GRCm39) missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19,290,107 (GRCm39) missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19,301,223 (GRCm39) missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19,286,662 (GRCm39) missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19,286,089 (GRCm39) nonsense probably null
R0545:Vmn2r98 UTSW 17 19,273,875 (GRCm39) missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19,300,759 (GRCm39) missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19,300,782 (GRCm39) missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19,301,011 (GRCm39) missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19,286,210 (GRCm39) missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19,285,440 (GRCm39) missense probably damaging 1.00
R1643:Vmn2r98 UTSW 17 19,301,170 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19,286,702 (GRCm39) missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19,286,680 (GRCm39) missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19,285,595 (GRCm39) nonsense probably null
R2165:Vmn2r98 UTSW 17 19,301,553 (GRCm39) missense unknown
R2238:Vmn2r98 UTSW 17 19,286,213 (GRCm39) missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19,300,698 (GRCm39) missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19,286,081 (GRCm39) missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19,301,439 (GRCm39) missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19,287,664 (GRCm39) missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19,300,887 (GRCm39) missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19,286,354 (GRCm39) missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19,290,007 (GRCm39) missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19,286,602 (GRCm39) missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19,286,419 (GRCm39) missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19,286,306 (GRCm39) missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19,273,815 (GRCm39) missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19,300,981 (GRCm39) missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19,290,016 (GRCm39) nonsense probably null
R5371:Vmn2r98 UTSW 17 19,290,015 (GRCm39) missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19,301,161 (GRCm39) missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19,286,260 (GRCm39) missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19,286,336 (GRCm39) missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19,286,143 (GRCm39) missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19,286,063 (GRCm39) missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19,285,510 (GRCm39) missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19,286,530 (GRCm39) missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19,301,184 (GRCm39) missense probably benign
R7068:Vmn2r98 UTSW 17 19,285,575 (GRCm39) missense probably benign
R7607:Vmn2r98 UTSW 17 19,287,570 (GRCm39) missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19,300,797 (GRCm39) missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19,287,460 (GRCm39) splice site probably null
R7915:Vmn2r98 UTSW 17 19,287,493 (GRCm39) missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19,273,912 (GRCm39) missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19,301,425 (GRCm39) missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19,301,031 (GRCm39) missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19,286,532 (GRCm39) missense probably benign
R8952:Vmn2r98 UTSW 17 19,285,531 (GRCm39) missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19,301,481 (GRCm39) missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19,286,777 (GRCm39) missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19,287,517 (GRCm39) missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19,301,496 (GRCm39) missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19,285,665 (GRCm39) missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19,287,685 (GRCm39) nonsense probably null
Z1177:Vmn2r98 UTSW 17 19,285,398 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCATTTTGGACACTGTTGCTCTGAACAT -3'
(R):5'- CCCCAAAACAGATTTTCCTCCAGTACAT -3'

Sequencing Primer
(F):5'- GCTATTCTGAACAGTCAGGTTTTCAC -3'
(R):5'- TTCCTCCAGTACATTAACACATGAG -3'
Posted On 2014-04-24