Incidental Mutation 'R1629:Lrfn4'
ID172705
Institutional Source Beutler Lab
Gene Symbol Lrfn4
Ensembl Gene ENSMUSG00000045045
Gene Nameleucine rich repeat and fibronectin type III domain containing 4
SynonymsSALM3
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R1629 (G1)
Quality Score202
Status Not validated
Chromosome19
Chromosomal Location4611785-4615667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4613495 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 337 (E337G)
Ref Sequence ENSEMBL: ENSMUSP00000109453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053597] [ENSMUST00000068004] [ENSMUST00000113822] [ENSMUST00000113825] [ENSMUST00000224726]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053597
AA Change: E337G

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050039
Gene: ENSMUSG00000045045
AA Change: E337G

DomainStartEndE-ValueType
LRRNT 16 52 1.16e0 SMART
LRR 71 94 3.86e0 SMART
LRR_TYP 95 118 9.44e-2 SMART
LRR 120 142 1.23e0 SMART
LRR 144 166 1.09e1 SMART
LRR_TYP 168 191 7.37e-4 SMART
LRR 192 215 1.45e1 SMART
LRRCT 234 279 1.27e-3 SMART
IGc2 293 358 3.35e-14 SMART
FN3 403 484 1.77e-2 SMART
transmembrane domain 517 539 N/A INTRINSIC
low complexity region 565 585 N/A INTRINSIC
low complexity region 614 626 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068004
SMART Domains Protein: ENSMUSP00000063825
Gene: ENSMUSG00000024892

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:CPSase_L_chain 37 147 3.3e-45 PFAM
Pfam:ATP-grasp_4 149 334 3.9e-19 PFAM
Pfam:CPSase_L_D2 152 361 7.2e-77 PFAM
Pfam:Dala_Dala_lig_C 161 329 1.5e-11 PFAM
Biotin_carb_C 376 483 1.21e-50 SMART
low complexity region 513 541 N/A INTRINSIC
Pfam:HMGL-like 564 838 8.2e-29 PFAM
Pfam:PYC_OADA 862 1062 1.4e-72 PFAM
Pfam:Biotin_lipoyl 1111 1178 1.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113822
AA Change: E337G

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109453
Gene: ENSMUSG00000045045
AA Change: E337G

DomainStartEndE-ValueType
LRRNT 16 52 1.16e0 SMART
LRR 71 94 3.86e0 SMART
LRR_TYP 95 118 9.44e-2 SMART
LRR 120 142 1.23e0 SMART
LRR 144 166 1.09e1 SMART
LRR_TYP 168 191 7.37e-4 SMART
LRR 192 215 1.45e1 SMART
LRRCT 234 279 1.27e-3 SMART
IGc2 293 358 3.35e-14 SMART
FN3 403 484 1.77e-2 SMART
transmembrane domain 517 539 N/A INTRINSIC
low complexity region 565 585 N/A INTRINSIC
low complexity region 614 626 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113825
SMART Domains Protein: ENSMUSP00000109456
Gene: ENSMUSG00000024892

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:CPSase_L_chain 36 146 1.1e-43 PFAM
Pfam:ATP-grasp_4 148 332 2.9e-19 PFAM
Pfam:CPSase_L_D2 151 360 4.2e-77 PFAM
Pfam:Dala_Dala_lig_C 158 328 7.9e-13 PFAM
Biotin_carb_C 375 482 1.21e-50 SMART
low complexity region 512 540 N/A INTRINSIC
Pfam:HMGL-like 571 821 3.4e-28 PFAM
Pfam:PYC_OADA 861 1062 3.4e-69 PFAM
Pfam:Biotin_lipoyl 1110 1177 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224726
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display hypoactivity and a decreased excitatory synapse number in the hippocampal CA1 region, but show normal synaptic plasticity and hippocampus-dependent learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Lrfn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0715:Lrfn4 UTSW 19 4612640 critical splice acceptor site probably null
R1103:Lrfn4 UTSW 19 4613271 missense probably benign 0.00
R4406:Lrfn4 UTSW 19 4613271 missense probably benign 0.00
R4459:Lrfn4 UTSW 19 4612634 missense probably benign
R5543:Lrfn4 UTSW 19 4612163 missense probably benign 0.41
R6115:Lrfn4 UTSW 19 4613909 missense probably damaging 1.00
R6554:Lrfn4 UTSW 19 4613886 missense probably damaging 0.98
R7626:Lrfn4 UTSW 19 4613651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCTAGCAGAAGCAGCAATGTCC -3'
(R):5'- AACCCACTGCACTGCAACTGTG -3'

Sequencing Primer
(F):5'- CAATGTCCGAAGGCCCAG -3'
(R):5'- ATGACCTGGAAACCTGCG -3'
Posted On2014-04-24