Mutagenetix > Incidental Mutations

Incidental Mutation 'R1629:Cfap58'

172706

Institutional Source

Beutler Lab

Gene Symbol

Cfap58

Ensembl Gene

ENSMUSG00000046585

Gene Name

cilia and flagella associated protein 58

Synonyms

LOC381229, Ccdc147

MMRRC Submission

039666-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.318) question?

Stock #

R1629 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47937712-48035379 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 47941339 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 80 (T80A)

Ref Sequence

ENSEMBL: ENSMUSP00000070533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066308]

Predicted Effect

probably benign
Transcript: ENSMUST00000066308
AA Change: T80A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000070533
Gene: ENSMUSG00000046585
AA Change: T80A

Domain	Start	End	E-Value	Type
coiled coil region	106	579	N/A	INTRINSIC
coiled coil region	642	706	N/A	INTRINSIC
low complexity region	740	762	N/A	INTRINSIC
coiled coil region	772	832	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	A	C	18: 58,954,619	I574L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
BC005624	T	C	2: 30,974,008	E191G	probably damaging	Het
Cbx2	A	G	11: 119,028,980	D457G	probably damaging	Het
Ccdc110	A	G	8: 45,942,127	K352E	probably benign	Het
Cdk14	A	T	5: 5,103,807	H183Q	probably benign	Het
Cftr	C	T	6: 18,226,106	T351I	probably damaging	Het
Col27a1	A	G	4: 63,329,863		probably benign	Het
Cp	T	A	3: 19,966,450		probably null	Het
Cpne8	A	T	15: 90,571,972	V196E	probably benign	Het
Dmxl1	T	G	18: 49,859,286		probably null	Het
Dnm2	T	A	9: 21,504,458	L642Q	probably damaging	Het
Dock2	G	T	11: 34,262,480		probably null	Het
Dock9	A	G	14: 121,543,574	F2091L	possibly damaging	Het
Eaf2	A	G	16: 36,824,701	V53A	probably damaging	Het
Fam208b	T	C	13: 3,574,121	H1943R	possibly damaging	Het
Fbl	G	T	7: 28,174,787		probably benign	Het
Fbn2	T	C	18: 58,026,538	D2373G	probably damaging	Het
Gbp2b	A	G	3: 142,610,974	Y462C	possibly damaging	Het
Il1rl2	T	A	1: 40,356,860	F348I	probably benign	Het
Khdc1a	T	A	1: 21,350,897	I102N	possibly damaging	Het
Klhl11	T	C	11: 100,464,186	T270A	probably benign	Het
Lama1	T	C	17: 67,805,428	S2288P	probably benign	Het
Lrfn4	T	C	19: 4,613,495	E337G	possibly damaging	Het
Macf1	C	A	4: 123,508,415	E549*	probably null	Het
Mmp3	G	T	9: 7,447,641	V209F	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myh9	G	A	15: 77,764,401	R1725W	probably damaging	Het
Nbea	A	T	3: 56,002,891	D1294E	possibly damaging	Het
Nrcam	G	A	12: 44,563,986	A496T	probably benign	Het
Nufip2	A	G	11: 77,693,008	T583A	probably benign	Het
Olfr1033	A	G	2: 86,041,422	T36A	probably damaging	Het
Ppig	C	A	2: 69,735,873	T128K	probably damaging	Het
Ppp2r2a	A	T	14: 67,019,759	C341S	possibly damaging	Het
Ptpre	A	T	7: 135,669,799	D374V	probably damaging	Het
Ranbp3l	A	C	15: 9,064,988	Q485P	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Slc1a7	A	G	4: 108,008,143	Y276C	probably damaging	Het
Smarcad1	A	G	6: 65,067,107	D221G	probably benign	Het
Smn1	C	A	13: 100,127,896	T45N	probably damaging	Het
Son	T	C	16: 91,657,622	S1086P	probably damaging	Het
Ssmem1	T	A	6: 30,512,492	Y45N	possibly damaging	Het
Tmem184c	A	C	8: 77,602,922	F170V	possibly damaging	Het
Tmem184c	A	T	8: 77,606,162		probably null	Het
Vmn1r59	C	T	7: 5,454,467	C98Y	probably damaging	Het
Vmn2r23	T	A	6: 123,713,427	S421T	probably benign	Het
Vmn2r98	T	C	17: 19,067,383	S493P	possibly damaging	Het

Other mutations in Cfap58

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01688:Cfap58	APN	19	47974567	missense	probably benign	0.30
IGL02068:Cfap58	APN	19	47986512	missense	probably damaging	1.00
IGL02609:Cfap58	APN	19	47975502	missense	possibly damaging	0.80
IGL03376:Cfap58	APN	19	48034725	missense	possibly damaging	0.60
PIT4515001:Cfap58	UTSW	19	48034683	missense	probably benign
PIT4618001:Cfap58	UTSW	19	47975514	missense	probably damaging	1.00
R0015:Cfap58	UTSW	19	48029100	missense	probably benign	0.45
R0015:Cfap58	UTSW	19	48029100	missense	probably benign	0.45
R0454:Cfap58	UTSW	19	47974680	critical splice donor site	probably null
R0545:Cfap58	UTSW	19	47941097	splice site	probably benign
R0789:Cfap58	UTSW	19	47955309	missense	probably benign	0.09
R0926:Cfap58	UTSW	19	47962562	missense	probably damaging	0.96
R1148:Cfap58	UTSW	19	47988504	missense	probably damaging	0.96
R1148:Cfap58	UTSW	19	47988504	missense	probably damaging	0.96
R1462:Cfap58	UTSW	19	47962430	missense	probably damaging	1.00
R1462:Cfap58	UTSW	19	47962430	missense	probably damaging	1.00
R1493:Cfap58	UTSW	19	47988504	missense	probably damaging	0.96
R1541:Cfap58	UTSW	19	47983530	missense	probably damaging	1.00
R1648:Cfap58	UTSW	19	47955405	missense	probably benign	0.13
R1837:Cfap58	UTSW	19	48029139	missense	probably damaging	0.98
R2307:Cfap58	UTSW	19	47962486	nonsense	probably null
R2513:Cfap58	UTSW	19	47962542	missense	probably benign	0.03
R3802:Cfap58	UTSW	19	47953059	missense	possibly damaging	0.81
R4233:Cfap58	UTSW	19	47975555	missense	possibly damaging	0.60
R4258:Cfap58	UTSW	19	47949484	splice site	probably null
R4414:Cfap58	UTSW	19	47953041	missense	possibly damaging	0.87
R4763:Cfap58	UTSW	19	47983506	missense	probably damaging	1.00
R5300:Cfap58	UTSW	19	47941156	missense	probably benign	0.09
R5406:Cfap58	UTSW	19	48029102	missense	possibly damaging	0.81
R5497:Cfap58	UTSW	19	48029109	missense	probably benign	0.08
R5635:Cfap58	UTSW	19	47983542	missense	possibly damaging	0.47
R6315:Cfap58	UTSW	19	47941277	missense	probably benign	0.40
R6483:Cfap58	UTSW	19	47983452	missense	probably benign	0.00
R6727:Cfap58	UTSW	19	47955417	missense	probably benign	0.30
R6896:Cfap58	UTSW	19	47944187	missense	probably damaging	0.98
R7461:Cfap58	UTSW	19	47982122	missense	possibly damaging	0.70
R7473:Cfap58	UTSW	19	47974625	nonsense	probably null
R7613:Cfap58	UTSW	19	47982122	missense	possibly damaging	0.70
R7650:Cfap58	UTSW	19	47986528	missense	possibly damaging	0.84
R7982:Cfap58	UTSW	19	47974567	missense	probably benign	0.30
R8083:Cfap58	UTSW	19	47983518	missense	probably damaging	1.00
R8121:Cfap58	UTSW	19	48029104	missense	probably benign	0.40
R8321:Cfap58	UTSW	19	47958147	missense	probably damaging	0.99
R8396:Cfap58	UTSW	19	48029101	missense	probably damaging	1.00
R8462:Cfap58	UTSW	19	47983650	missense	possibly damaging	0.94
X0067:Cfap58	UTSW	19	47955308	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCGCTCTTTCTCGCAGGACAAG -3'
(R):5'- TTTCAGCACAGTAAACCTCACCAGG -3'

Sequencing Primer
(F):5'- CCGGAGGAAACTGCATTTG -3'
(R):5'- AACCTCACCAGGGTTAATTACTTTC -3'

Posted On

2014-04-24