Incidental Mutation 'R1630:Ttll11'
Institutional Source Beutler Lab
Gene Symbol Ttll11
Ensembl Gene ENSMUSG00000026885
Gene Nametubulin tyrosine ligase-like family, member 11
Synonyms4932702F08Rik, 4933424A20Rik, D2Ertd624e
MMRRC Submission 039667-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1630 (G1)
Quality Score225
Status Validated
Chromosomal Location35751241-35979913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35889325 bp
Amino Acid Change Valine to Alanine at position 471 (V471A)
Ref Sequence ENSEMBL: ENSMUSP00000108600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028248] [ENSMUST00000112976] [ENSMUST00000161970]
Predicted Effect probably damaging
Transcript: ENSMUST00000028248
AA Change: V471A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028248
Gene: ENSMUSG00000026885
AA Change: V471A

low complexity region 11 37 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
Pfam:TTL 170 477 9.1e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112976
AA Change: V471A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108600
Gene: ENSMUSG00000026885
AA Change: V471A

low complexity region 11 37 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
Pfam:TTL 170 477 5.9e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160284
Predicted Effect unknown
Transcript: ENSMUST00000160906
AA Change: V287A
SMART Domains Protein: ENSMUSP00000125511
Gene: ENSMUSG00000026885
AA Change: V287A

Pfam:TTL 1 304 4.2e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161970
SMART Domains Protein: ENSMUSP00000125627
Gene: ENSMUSG00000026885

SCOP:d1gosa1 33 88 5e-3 SMART
low complexity region 107 122 N/A INTRINSIC
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429P17Rik C A 13: 47,960,725 noncoding transcript Het
9930012K11Rik T C 14: 70,157,180 E175G probably benign Het
A630091E08Rik A G 7: 98,543,607 noncoding transcript Het
Atm A T 9: 53,479,673 L1867Q probably damaging Het
Atp5a1 A G 18: 77,777,567 D63G possibly damaging Het
Baz2b A T 2: 60,006,130 S20T unknown Het
C1qtnf7 G A 5: 43,609,161 C34Y possibly damaging Het
Cactin A G 10: 81,323,725 T353A probably benign Het
Cdyl A G 13: 35,683,803 K21E possibly damaging Het
Crispld1 A G 1: 17,728,798 T48A probably benign Het
Csmd3 T A 15: 47,838,522 T1722S possibly damaging Het
Dapk1 A T 13: 60,729,531 E528V probably damaging Het
Dennd4a A G 9: 64,871,882 D549G probably benign Het
Dnajc5b C A 3: 19,574,741 N66K probably damaging Het
Dusp16 G T 6: 134,720,561 R250S probably damaging Het
F10 A G 8: 13,055,551 N384S probably benign Het
Gabrr2 A G 4: 33,085,647 S331G probably damaging Het
Gm12185 A C 11: 48,907,890 I592S probably benign Het
Gm9755 T C 8: 67,514,660 noncoding transcript Het
Hspg2 T C 4: 137,518,435 L913P probably damaging Het
Ifna1 T A 4: 88,850,329 S81R probably benign Het
Iqgap2 T C 13: 95,689,785 K510E probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,102,901 Y140H probably damaging Het
Lix1 A G 17: 17,457,158 H205R probably damaging Het
Masp2 A T 4: 148,614,033 T524S probably benign Het
Mndal A C 1: 173,874,392 F115V possibly damaging Het
Morc3 C A 16: 93,866,533 N541K probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Nes T A 3: 87,977,677 V1037E probably benign Het
Nfkbil1 A G 17: 35,221,164 W178R probably damaging Het
Nobox A T 6: 43,307,212 C8* probably null Het
Nwd1 A G 8: 72,667,029 T348A possibly damaging Het
Olfr1048 A G 2: 86,236,086 S243P probably damaging Het
Olfr1350 T C 7: 6,570,674 S228P probably damaging Het
Olfr382 T C 11: 73,516,720 T160A probably damaging Het
Osbp2 T C 11: 3,717,167 T448A probably benign Het
Plrg1 A G 3: 83,058,763 D75G probably benign Het
Ppp1r8 T C 4: 132,829,437 E213G probably benign Het
Rad54l2 A G 9: 106,703,629 F898L possibly damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl10a G C 11: 5,059,542 R110P probably damaging Het
Rttn T C 18: 89,042,954 I1082T probably benign Het
Sema6d A G 2: 124,664,345 D734G possibly damaging Het
Sgce C T 6: 4,719,476 V44M probably damaging Het
Sgo2b A G 8: 63,927,797 V667A possibly damaging Het
Shcbp1 A T 8: 4,748,763 C118* probably null Het
Slain2 C T 5: 72,976,004 P563S probably damaging Het
Slco1b2 A T 6: 141,656,821 I167F probably damaging Het
Speg T C 1: 75,422,977 L2356P probably damaging Het
Sptbn4 A G 7: 27,418,739 V305A probably benign Het
Sspo G A 6: 48,457,724 R1050H probably benign Het
Tmem106b A G 6: 13,081,541 N149S probably benign Het
Tmem200a T C 10: 25,992,914 T486A probably damaging Het
Tmem212 T A 3: 27,885,101 T79S possibly damaging Het
Vill A G 9: 119,070,701 N318D probably benign Het
Vmn2r102 A G 17: 19,678,770 D458G possibly damaging Het
Zfp472 T A 17: 32,977,978 C342* probably null Het
Zfp963 A T 8: 69,744,187 probably benign Het
Other mutations in Ttll11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Ttll11 APN 2 35902720 nonsense probably null
IGL01148:Ttll11 APN 2 35784193 missense probably damaging 0.96
IGL02933:Ttll11 APN 2 35979410 missense probably benign
e-suppressor UTSW 2 35752406 missense probably damaging 1.00
R0356:Ttll11 UTSW 2 35902676 missense possibly damaging 0.66
R0494:Ttll11 UTSW 2 35944874 missense probably damaging 1.00
R1494:Ttll11 UTSW 2 35795379 missense probably damaging 1.00
R1688:Ttll11 UTSW 2 35795379 missense probably damaging 1.00
R1939:Ttll11 UTSW 2 35940753 missense probably null
R2414:Ttll11 UTSW 2 35979534 missense unknown
R2986:Ttll11 UTSW 2 35817738 missense probably benign 0.00
R4295:Ttll11 UTSW 2 35979552 small deletion probably benign
R4346:Ttll11 UTSW 2 35784118 missense probably benign 0.22
R5234:Ttll11 UTSW 2 35940733 missense probably damaging 1.00
R5340:Ttll11 UTSW 2 35902789 missense probably damaging 0.99
R5442:Ttll11 UTSW 2 35903123 makesense probably null
R5482:Ttll11 UTSW 2 35752406 missense probably damaging 1.00
R5604:Ttll11 UTSW 2 35817786 missense probably benign 0.07
R6219:Ttll11 UTSW 2 35752499 splice site probably null
R6481:Ttll11 UTSW 2 35902754 missense probably damaging 1.00
R6764:Ttll11 UTSW 2 35890448 splice site probably null
R6944:Ttll11 UTSW 2 35752294 missense probably benign 0.05
R7224:Ttll11 UTSW 2 35902673 missense probably damaging 1.00
R7511:Ttll11 UTSW 2 35903034 missense probably damaging 1.00
R8030:Ttll11 UTSW 2 35902673 missense probably damaging 1.00
R8052:Ttll11 UTSW 2 35979515 missense unknown
R8200:Ttll11 UTSW 2 35944928 missense probably damaging 1.00
R8332:Ttll11 UTSW 2 35940709 missense possibly damaging 0.85
X0026:Ttll11 UTSW 2 35795352 splice site probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- atagtcccaggagtccagag -3'
Posted On2014-04-24