Mutagenetix > Incidental Mutations

Incidental Mutation 'R1630:Baz2b'

172713

Institutional Source

Beutler Lab

Gene Symbol

Baz2b

Ensembl Gene

ENSMUSG00000026987

Gene Name

bromodomain adjacent to zinc finger domain, 2B

Synonyms

D2Ertd794e, 5830435C13Rik

MMRRC Submission

039667-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.257) question?

Stock #

R1630 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59899363-60209839 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 60006130 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 20 (S20T)

Ref Sequence

ENSEMBL: ENSMUSP00000108169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]

Predicted Effect

unknown
Transcript: ENSMUST00000090925
AA Change: S20T

SMART Domains

Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: S20T

Domain	Start	End	E-Value	Type
low complexity region	7	46	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
low complexity region	147	162	N/A	INTRINSIC
low complexity region	193	244	N/A	INTRINSIC
low complexity region	291	308	N/A	INTRINSIC
low complexity region	366	385	N/A	INTRINSIC
low complexity region	528	540	N/A	INTRINSIC
low complexity region	554	614	N/A	INTRINSIC
low complexity region	628	637	N/A	INTRINSIC
low complexity region	671	685	N/A	INTRINSIC
Pfam:MBD	690	742	1e-12	PFAM
low complexity region	759	774	N/A	INTRINSIC
coiled coil region	814	975	N/A	INTRINSIC
DDT	1004	1069	1.19e-20	SMART
low complexity region	1199	1212	N/A	INTRINSIC
low complexity region	1213	1247	N/A	INTRINSIC
coiled coil region	1251	1286	N/A	INTRINSIC
low complexity region	1320	1337	N/A	INTRINSIC
low complexity region	1503	1524	N/A	INTRINSIC
low complexity region	1569	1582	N/A	INTRINSIC
low complexity region	1585	1605	N/A	INTRINSIC
Blast:BROMO	1802	1843	7e-18	BLAST
PHD	1888	1934	1.71e-12	SMART
low complexity region	1942	1964	N/A	INTRINSIC
low complexity region	1968	1980	N/A	INTRINSIC
BROMO	2013	2121	3.85e-41	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000112550
AA Change: S20T

SMART Domains

Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: S20T

Domain	Start	End	E-Value	Type
low complexity region	7	46	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
low complexity region	147	162	N/A	INTRINSIC
low complexity region	193	244	N/A	INTRINSIC
low complexity region	291	308	N/A	INTRINSIC
low complexity region	366	385	N/A	INTRINSIC
low complexity region	528	540	N/A	INTRINSIC
low complexity region	554	614	N/A	INTRINSIC
low complexity region	628	637	N/A	INTRINSIC
low complexity region	671	685	N/A	INTRINSIC
Pfam:MBD	690	741	3.4e-13	PFAM
low complexity region	759	774	N/A	INTRINSIC
coiled coil region	814	975	N/A	INTRINSIC
DDT	1004	1069	1.19e-20	SMART
low complexity region	1199	1212	N/A	INTRINSIC
low complexity region	1213	1247	N/A	INTRINSIC
coiled coil region	1251	1286	N/A	INTRINSIC
low complexity region	1320	1337	N/A	INTRINSIC
low complexity region	1503	1524	N/A	INTRINSIC
low complexity region	1569	1582	N/A	INTRINSIC
low complexity region	1585	1605	N/A	INTRINSIC
Pfam:WHIM3	1638	1676	5.1e-14	PFAM
Blast:BROMO	1802	1843	7e-18	BLAST
PHD	1888	1934	1.71e-12	SMART
low complexity region	1942	1964	N/A	INTRINSIC
low complexity region	1968	1980	N/A	INTRINSIC
BROMO	2013	2121	3.85e-41	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129124

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137480

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153711

Meta Mutation Damage Score

0.0666

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.1%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429P17Rik	C	A	13: 47,960,725		noncoding transcript	Het
9930012K11Rik	T	C	14: 70,157,180	E175G	probably benign	Het
A630091E08Rik	A	G	7: 98,543,607		noncoding transcript	Het
Atm	A	T	9: 53,479,673	L1867Q	probably damaging	Het
Atp5a1	A	G	18: 77,777,567	D63G	possibly damaging	Het
C1qtnf7	G	A	5: 43,609,161	C34Y	possibly damaging	Het
Cactin	A	G	10: 81,323,725	T353A	probably benign	Het
Cdyl	A	G	13: 35,683,803	K21E	possibly damaging	Het
Crispld1	A	G	1: 17,728,798	T48A	probably benign	Het
Csmd3	T	A	15: 47,838,522	T1722S	possibly damaging	Het
Dapk1	A	T	13: 60,729,531	E528V	probably damaging	Het
Dennd4a	A	G	9: 64,871,882	D549G	probably benign	Het
Dnajc5b	C	A	3: 19,574,741	N66K	probably damaging	Het
Dusp16	G	T	6: 134,720,561	R250S	probably damaging	Het
F10	A	G	8: 13,055,551	N384S	probably benign	Het
Gabrr2	A	G	4: 33,085,647	S331G	probably damaging	Het
Gm12185	A	C	11: 48,907,890	I592S	probably benign	Het
Gm9755	T	C	8: 67,514,660		noncoding transcript	Het
Hspg2	T	C	4: 137,518,435	L913P	probably damaging	Het
Ifna1	T	A	4: 88,850,329	S81R	probably benign	Het
Iqgap2	T	C	13: 95,689,785	K510E	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lhx6	A	G	2: 36,102,901	Y140H	probably damaging	Het
Lix1	A	G	17: 17,457,158	H205R	probably damaging	Het
Masp2	A	T	4: 148,614,033	T524S	probably benign	Het
Mndal	A	C	1: 173,874,392	F115V	possibly damaging	Het
Morc3	C	A	16: 93,866,533	N541K	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myocd	A	G	11: 65,196,394	S236P	probably damaging	Het
Nes	T	A	3: 87,977,677	V1037E	probably benign	Het
Nfkbil1	A	G	17: 35,221,164	W178R	probably damaging	Het
Nobox	A	T	6: 43,307,212	C8*	probably null	Het
Nwd1	A	G	8: 72,667,029	T348A	possibly damaging	Het
Olfr1048	A	G	2: 86,236,086	S243P	probably damaging	Het
Olfr1350	T	C	7: 6,570,674	S228P	probably damaging	Het
Olfr382	T	C	11: 73,516,720	T160A	probably damaging	Het
Osbp2	T	C	11: 3,717,167	T448A	probably benign	Het
Plrg1	A	G	3: 83,058,763	D75G	probably benign	Het
Ppp1r8	T	C	4: 132,829,437	E213G	probably benign	Het
Rad54l2	A	G	9: 106,703,629	F898L	possibly damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rasl10a	G	C	11: 5,059,542	R110P	probably damaging	Het
Rttn	T	C	18: 89,042,954	I1082T	probably benign	Het
Sema6d	A	G	2: 124,664,345	D734G	possibly damaging	Het
Sgce	C	T	6: 4,719,476	V44M	probably damaging	Het
Sgo2b	A	G	8: 63,927,797	V667A	possibly damaging	Het
Shcbp1	A	T	8: 4,748,763	C118*	probably null	Het
Slain2	C	T	5: 72,976,004	P563S	probably damaging	Het
Slco1b2	A	T	6: 141,656,821	I167F	probably damaging	Het
Speg	T	C	1: 75,422,977	L2356P	probably damaging	Het
Sptbn4	A	G	7: 27,418,739	V305A	probably benign	Het
Sspo	G	A	6: 48,457,724	R1050H	probably benign	Het
Tmem106b	A	G	6: 13,081,541	N149S	probably benign	Het
Tmem200a	T	C	10: 25,992,914	T486A	probably damaging	Het
Tmem212	T	A	3: 27,885,101	T79S	possibly damaging	Het
Ttll11	A	G	2: 35,889,325	V471A	probably damaging	Het
Vill	A	G	9: 119,070,701	N318D	probably benign	Het
Vmn2r102	A	G	17: 19,678,770	D458G	possibly damaging	Het
Zfp472	T	A	17: 32,977,978	C342*	probably null	Het
Zfp963	A	T	8: 69,744,187		probably benign	Het

Other mutations in Baz2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Baz2b	APN	2	59912795	missense	probably benign	0.02
IGL00476:Baz2b	APN	2	59913739	missense	probably benign	0.06
IGL00489:Baz2b	APN	2	59957675	nonsense	probably null
IGL00514:Baz2b	APN	2	59962477	missense	probably benign	0.11
IGL00678:Baz2b	APN	2	60006183	missense	unknown
IGL01348:Baz2b	APN	2	59933687	missense	possibly damaging	0.95
IGL01354:Baz2b	APN	2	59968889	missense	probably benign	0.18
IGL01924:Baz2b	APN	2	59935271	missense	probably damaging	1.00
IGL02125:Baz2b	APN	2	59968640	missense	probably benign	0.12
IGL02314:Baz2b	APN	2	59962227	missense	probably benign
IGL02370:Baz2b	APN	2	59923589	missense	possibly damaging	0.77
IGL02473:Baz2b	APN	2	59960063	missense	probably benign	0.40
IGL02499:Baz2b	APN	2	59901496	missense	possibly damaging	0.60
IGL02609:Baz2b	APN	2	59917369	missense	possibly damaging	0.77
IGL02705:Baz2b	APN	2	59948260	missense	possibly damaging	0.92
IGL02711:Baz2b	APN	2	59917505	unclassified	probably benign
IGL02716:Baz2b	APN	2	59962524	missense	possibly damaging	0.53
IGL02724:Baz2b	APN	2	59977374	missense	possibly damaging	0.70
IGL02750:Baz2b	APN	2	59968658	missense	possibly damaging	0.73
IGL02869:Baz2b	APN	2	59977528	missense	probably benign	0.00
IGL02886:Baz2b	APN	2	59957743	splice site	probably null
IGL02892:Baz2b	APN	2	59900736	missense	probably damaging	1.00
IGL03132:Baz2b	APN	2	59907753	splice site	probably benign
IGL03183:Baz2b	APN	2	59903296	missense	probably benign	0.10
IGL03197:Baz2b	APN	2	59901554	missense	possibly damaging	0.74
R0054:Baz2b	UTSW	2	59932166	missense	probably damaging	1.00
R0054:Baz2b	UTSW	2	59932166	missense	probably damaging	1.00
R0122:Baz2b	UTSW	2	59913619	splice site	probably null
R0136:Baz2b	UTSW	2	59901954	missense	probably benign	0.22
R0144:Baz2b	UTSW	2	59907495	missense	probably damaging	0.98
R0403:Baz2b	UTSW	2	59969377	missense	possibly damaging	0.70
R0498:Baz2b	UTSW	2	59901996	unclassified	probably benign
R0528:Baz2b	UTSW	2	59936739	missense	probably damaging	1.00
R1025:Baz2b	UTSW	2	59962482	missense	probably benign	0.06
R1470:Baz2b	UTSW	2	59978546	missense	possibly damaging	0.53
R1470:Baz2b	UTSW	2	59978546	missense	possibly damaging	0.53
R1510:Baz2b	UTSW	2	59922209	missense	probably damaging	1.00
R1511:Baz2b	UTSW	2	59962024	missense	probably benign	0.12
R1514:Baz2b	UTSW	2	59962326	missense	probably benign	0.13
R1519:Baz2b	UTSW	2	59948254	missense	possibly damaging	0.50
R1523:Baz2b	UTSW	2	59968637	missense	possibly damaging	0.47
R1641:Baz2b	UTSW	2	59912890	missense	probably damaging	0.99
R1674:Baz2b	UTSW	2	59912992	missense	possibly damaging	0.53
R1778:Baz2b	UTSW	2	60006136	missense	unknown
R1826:Baz2b	UTSW	2	59968733	missense	probably benign	0.12
R1835:Baz2b	UTSW	2	59901819	missense	probably benign	0.02
R1954:Baz2b	UTSW	2	59968743	missense	probably benign	0.12
R1981:Baz2b	UTSW	2	59923680	missense	possibly damaging	0.95
R2029:Baz2b	UTSW	2	59912723	unclassified	probably benign
R2567:Baz2b	UTSW	2	59913911	missense	possibly damaging	0.82
R2842:Baz2b	UTSW	2	59913004	missense	probably benign	0.27
R2848:Baz2b	UTSW	2	59924666	missense	possibly damaging	0.64
R3809:Baz2b	UTSW	2	59968896	missense	probably benign	0.12
R3935:Baz2b	UTSW	2	59912761	missense	possibly damaging	0.81
R3936:Baz2b	UTSW	2	59912761	missense	possibly damaging	0.81
R4072:Baz2b	UTSW	2	59912573	splice site	probably null
R4182:Baz2b	UTSW	2	60098457	intron	probably benign
R4255:Baz2b	UTSW	2	59920572	unclassified	probably benign
R4359:Baz2b	UTSW	2	59901613	missense	possibly damaging	0.87
R4716:Baz2b	UTSW	2	59969255	missense	probably benign	0.06
R4743:Baz2b	UTSW	2	59913911	missense	probably benign	0.01
R4772:Baz2b	UTSW	2	59958451	missense	probably damaging	0.96
R4858:Baz2b	UTSW	2	59907743	missense	probably benign
R4868:Baz2b	UTSW	2	59924882	missense	possibly damaging	0.65
R4872:Baz2b	UTSW	2	59942759	splice site	probably null
R4889:Baz2b	UTSW	2	59936726	missense	probably damaging	1.00
R4890:Baz2b	UTSW	2	59926039	missense	probably damaging	0.99
R4914:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R4915:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R4918:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R5027:Baz2b	UTSW	2	60098644	intron	probably benign
R5031:Baz2b	UTSW	2	59912807	missense	probably benign	0.00
R5082:Baz2b	UTSW	2	59901491	nonsense	probably null
R5133:Baz2b	UTSW	2	59962024	missense	probably benign	0.12
R5276:Baz2b	UTSW	2	59962614	missense	probably benign	0.40
R5279:Baz2b	UTSW	2	59932152	missense	probably damaging	1.00
R5294:Baz2b	UTSW	2	59978602	missense	probably benign	0.11
R5447:Baz2b	UTSW	2	59913988	missense	probably damaging	0.99
R5903:Baz2b	UTSW	2	59959889	missense	probably damaging	0.99
R5910:Baz2b	UTSW	2	59977426	missense	possibly damaging	0.88
R6140:Baz2b	UTSW	2	59912527	missense	probably damaging	0.99
R6195:Baz2b	UTSW	2	59907511	missense	possibly damaging	0.89
R6199:Baz2b	UTSW	2	59978675	missense	probably benign	0.00
R6208:Baz2b	UTSW	2	59924806	missense	probably damaging	1.00
R6233:Baz2b	UTSW	2	59907511	missense	possibly damaging	0.89
R6276:Baz2b	UTSW	2	59948223	missense	probably damaging	1.00
R6324:Baz2b	UTSW	2	59906948	missense	probably damaging	1.00
R6490:Baz2b	UTSW	2	59901729	missense	probably damaging	1.00
R6578:Baz2b	UTSW	2	59969279	missense	possibly damaging	0.47
R6720:Baz2b	UTSW	2	59924890	missense	probably damaging	1.00
R6760:Baz2b	UTSW	2	59962432	missense	probably benign	0.40
R6836:Baz2b	UTSW	2	59917425	missense	probably damaging	1.00
R6859:Baz2b	UTSW	2	59901530	missense	probably benign	0.01
R6880:Baz2b	UTSW	2	59912939	missense	probably damaging	0.99
R6916:Baz2b	UTSW	2	59968776	missense	probably benign
R6978:Baz2b	UTSW	2	59907715	missense	possibly damaging	0.84
R7037:Baz2b	UTSW	2	59933670	critical splice donor site	probably null
R7112:Baz2b	UTSW	2	59962184	missense	possibly damaging	0.53
R7117:Baz2b	UTSW	2	59912497	missense
R7198:Baz2b	UTSW	2	59962206	missense	probably benign	0.00
R7270:Baz2b	UTSW	2	59962492	missense	possibly damaging	0.96
R7282:Baz2b	UTSW	2	59920437	missense	probably benign	0.17
R7464:Baz2b	UTSW	2	59977448	missense	possibly damaging	0.53
R7609:Baz2b	UTSW	2	59962473	missense	probably benign	0.40
R7703:Baz2b	UTSW	2	59917425	missense	probably damaging	1.00
R7850:Baz2b	UTSW	2	59936716	missense	probably damaging	0.98
R7851:Baz2b	UTSW	2	59936716	missense	probably damaging	0.98
R7988:Baz2b	UTSW	2	59962141	missense	possibly damaging	0.53
R8079:Baz2b	UTSW	2	59900768	missense	probably damaging	1.00
R8084:Baz2b	UTSW	2	59962236	missense	probably benign
R8343:Baz2b	UTSW	2	59901514	missense	probably damaging	1.00
R8348:Baz2b	UTSW	2	59911793	missense
R8438:Baz2b	UTSW	2	59917484	nonsense	probably null
R8448:Baz2b	UTSW	2	59911793	missense
R8511:Baz2b	UTSW	2	59901814	missense	probably benign
X0011:Baz2b	UTSW	2	59977361	missense	possibly damaging	0.53
X0053:Baz2b	UTSW	2	59900675	missense	probably damaging	1.00
X0064:Baz2b	UTSW	2	59969282	missense	probably benign
Z1088:Baz2b	UTSW	2	59960015	missense	probably damaging	1.00
Z1177:Baz2b	UTSW	2	59977520	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACTAGACTCTCAGGGAAGGGTTACGG -3'
(R):5'- TCCTCCTCTCACATTGAGGACTTAAGC -3'

Sequencing Primer
(F):5'- CTGAGTAATCAGGACTCTGCCAG -3'
(R):5'- TCACATTGAGGACTTAAGCCTGAG -3'

Posted On

2014-04-24