Incidental Mutation 'R1630:Masp2'
ID172724
Institutional Source Beutler Lab
Gene Symbol Masp2
Ensembl Gene ENSMUSG00000028979
Gene Namemannan-binding lectin serine peptidase 2
SynonymsMASP-2, MAp19
MMRRC Submission 039667-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R1630 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148602554-148615499 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148614033 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 524 (T524S)
Ref Sequence ENSEMBL: ENSMUSP00000049729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045180] [ENSMUST00000052060] [ENSMUST00000084125] [ENSMUST00000095719] [ENSMUST00000105699] [ENSMUST00000105700] [ENSMUST00000105702] [ENSMUST00000140897] [ENSMUST00000165113] [ENSMUST00000172073] [ENSMUST00000188134] [ENSMUST00000186729] [ENSMUST00000191450] [ENSMUST00000187939] [ENSMUST00000186711] [ENSMUST00000190696] [ENSMUST00000189048] [ENSMUST00000190552] [ENSMUST00000186947]
Predicted Effect probably benign
Transcript: ENSMUST00000045180
SMART Domains Protein: ENSMUSP00000038113
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052060
AA Change: T524S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000049729
Gene: ENSMUSG00000028979
AA Change: T524S

DomainStartEndE-ValueType
CUB 18 137 4.71e-30 SMART
EGF_CA 138 181 4.32e-10 SMART
CUB 184 296 4.29e-33 SMART
CCP 300 361 1.79e-12 SMART
CCP 366 429 5.4e-7 SMART
Tryp_SPc 443 678 1.3e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084125
SMART Domains Protein: ENSMUSP00000081142
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 273 316 N/A INTRINSIC
low complexity region 321 329 N/A INTRINSIC
low complexity region 342 358 N/A INTRINSIC
low complexity region 368 380 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095719
SMART Domains Protein: ENSMUSP00000093386
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 274 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105699
SMART Domains Protein: ENSMUSP00000101324
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105700
SMART Domains Protein: ENSMUSP00000101325
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105702
SMART Domains Protein: ENSMUSP00000101327
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140897
SMART Domains Protein: ENSMUSP00000135135
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
Blast:RRM_2 1 28 2e-13 BLAST
RRM 44 110 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154898
Predicted Effect probably benign
Transcript: ENSMUST00000165113
SMART Domains Protein: ENSMUSP00000129342
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172073
SMART Domains Protein: ENSMUSP00000130963
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 274 285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188380
Predicted Effect probably benign
Transcript: ENSMUST00000188134
SMART Domains Protein: ENSMUSP00000139476
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186729
SMART Domains Protein: ENSMUSP00000139547
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
Pfam:RRM_1 1 37 1.8e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188488
Predicted Effect probably benign
Transcript: ENSMUST00000185824
Predicted Effect probably benign
Transcript: ENSMUST00000190630
Predicted Effect probably benign
Transcript: ENSMUST00000191450
SMART Domains Protein: ENSMUSP00000140832
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 5.8e-20 SMART
RRM 192 258 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187939
SMART Domains Protein: ENSMUSP00000140928
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 18 84 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191378
Predicted Effect probably benign
Transcript: ENSMUST00000186711
Predicted Effect probably benign
Transcript: ENSMUST00000190696
SMART Domains Protein: ENSMUSP00000139637
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
Blast:RRM_2 55 79 8e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190287
Predicted Effect probably benign
Transcript: ENSMUST00000189048
SMART Domains Protein: ENSMUSP00000140364
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190552
SMART Domains Protein: ENSMUSP00000141052
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM_2 1 56 6.1e-4 SMART
RRM 72 138 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186947
SMART Domains Protein: ENSMUSP00000140529
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 5.8e-20 SMART
low complexity region 215 243 N/A INTRINSIC
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous disruption of the exon encoding the small mannose-binding lectin (MBL)-associated protein results in a defective lectin-mediated complement pathway with a 20% reduction in the ability of serum components to cleave C3 and C4 in the presence of mannose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429P17Rik C A 13: 47,960,725 noncoding transcript Het
9930012K11Rik T C 14: 70,157,180 E175G probably benign Het
A630091E08Rik A G 7: 98,543,607 noncoding transcript Het
Atm A T 9: 53,479,673 L1867Q probably damaging Het
Atp5a1 A G 18: 77,777,567 D63G possibly damaging Het
Baz2b A T 2: 60,006,130 S20T unknown Het
C1qtnf7 G A 5: 43,609,161 C34Y possibly damaging Het
Cactin A G 10: 81,323,725 T353A probably benign Het
Cdyl A G 13: 35,683,803 K21E possibly damaging Het
Crispld1 A G 1: 17,728,798 T48A probably benign Het
Csmd3 T A 15: 47,838,522 T1722S possibly damaging Het
Dapk1 A T 13: 60,729,531 E528V probably damaging Het
Dennd4a A G 9: 64,871,882 D549G probably benign Het
Dnajc5b C A 3: 19,574,741 N66K probably damaging Het
Dusp16 G T 6: 134,720,561 R250S probably damaging Het
F10 A G 8: 13,055,551 N384S probably benign Het
Gabrr2 A G 4: 33,085,647 S331G probably damaging Het
Gm12185 A C 11: 48,907,890 I592S probably benign Het
Gm9755 T C 8: 67,514,660 noncoding transcript Het
Hspg2 T C 4: 137,518,435 L913P probably damaging Het
Ifna1 T A 4: 88,850,329 S81R probably benign Het
Iqgap2 T C 13: 95,689,785 K510E probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,102,901 Y140H probably damaging Het
Lix1 A G 17: 17,457,158 H205R probably damaging Het
Mndal A C 1: 173,874,392 F115V possibly damaging Het
Morc3 C A 16: 93,866,533 N541K probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Nes T A 3: 87,977,677 V1037E probably benign Het
Nfkbil1 A G 17: 35,221,164 W178R probably damaging Het
Nobox A T 6: 43,307,212 C8* probably null Het
Nwd1 A G 8: 72,667,029 T348A possibly damaging Het
Olfr1048 A G 2: 86,236,086 S243P probably damaging Het
Olfr1350 T C 7: 6,570,674 S228P probably damaging Het
Olfr382 T C 11: 73,516,720 T160A probably damaging Het
Osbp2 T C 11: 3,717,167 T448A probably benign Het
Plrg1 A G 3: 83,058,763 D75G probably benign Het
Ppp1r8 T C 4: 132,829,437 E213G probably benign Het
Rad54l2 A G 9: 106,703,629 F898L possibly damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl10a G C 11: 5,059,542 R110P probably damaging Het
Rttn T C 18: 89,042,954 I1082T probably benign Het
Sema6d A G 2: 124,664,345 D734G possibly damaging Het
Sgce C T 6: 4,719,476 V44M probably damaging Het
Sgo2b A G 8: 63,927,797 V667A possibly damaging Het
Shcbp1 A T 8: 4,748,763 C118* probably null Het
Slain2 C T 5: 72,976,004 P563S probably damaging Het
Slco1b2 A T 6: 141,656,821 I167F probably damaging Het
Speg T C 1: 75,422,977 L2356P probably damaging Het
Sptbn4 A G 7: 27,418,739 V305A probably benign Het
Sspo G A 6: 48,457,724 R1050H probably benign Het
Tmem106b A G 6: 13,081,541 N149S probably benign Het
Tmem200a T C 10: 25,992,914 T486A probably damaging Het
Tmem212 T A 3: 27,885,101 T79S possibly damaging Het
Ttll11 A G 2: 35,889,325 V471A probably damaging Het
Vill A G 9: 119,070,701 N318D probably benign Het
Vmn2r102 A G 17: 19,678,770 D458G possibly damaging Het
Zfp472 T A 17: 32,977,978 C342* probably null Het
Zfp963 A T 8: 69,744,187 probably benign Het
Other mutations in Masp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Masp2 APN 4 148602729 missense probably benign 0.05
IGL01284:Masp2 APN 4 148614007 missense probably damaging 1.00
IGL02040:Masp2 APN 4 148603813 missense probably damaging 1.00
IGL02243:Masp2 APN 4 148603068 missense probably benign 0.32
IGL02490:Masp2 APN 4 148607943 missense possibly damaging 0.91
IGL02517:Masp2 APN 4 148614020 missense probably damaging 1.00
IGL02997:Masp2 APN 4 148603175 splice site probably benign
R0408:Masp2 UTSW 4 148606039 missense probably benign
R1517:Masp2 UTSW 4 148612106 missense possibly damaging 0.74
R1634:Masp2 UTSW 4 148614355 missense probably damaging 1.00
R1873:Masp2 UTSW 4 148614495 missense probably damaging 1.00
R2208:Masp2 UTSW 4 148614415 missense probably damaging 1.00
R2283:Masp2 UTSW 4 148606068 missense probably benign 0.00
R2876:Masp2 UTSW 4 148608001 missense probably benign
R3921:Masp2 UTSW 4 148605731 missense possibly damaging 0.95
R4586:Masp2 UTSW 4 148613901 missense probably damaging 1.00
R4753:Masp2 UTSW 4 148612151 missense probably benign 0.00
R4877:Masp2 UTSW 4 148602871 missense probably benign 0.00
R5169:Masp2 UTSW 4 148606114 missense probably damaging 0.96
R5512:Masp2 UTSW 4 148614069 missense probably damaging 1.00
R6161:Masp2 UTSW 4 148614012 missense possibly damaging 0.88
R6291:Masp2 UTSW 4 148602753 missense probably damaging 0.99
R7039:Masp2 UTSW 4 148602586 start codon destroyed probably benign 0.03
R7164:Masp2 UTSW 4 148610115 critical splice acceptor site probably null
R7183:Masp2 UTSW 4 148612157 missense probably benign 0.02
R7417:Masp2 UTSW 4 148605721 missense probably benign 0.02
R7718:Masp2 UTSW 4 148602747 missense probably damaging 1.00
R7748:Masp2 UTSW 4 148605706 missense probably benign 0.00
R7852:Masp2 UTSW 4 148602732 missense probably benign 0.00
R7986:Masp2 UTSW 4 148602826 missense probably damaging 1.00
R8078:Masp2 UTSW 4 148613778 missense probably benign 0.01
R8203:Masp2 UTSW 4 148612142 missense probably benign 0.00
R8257:Masp2 UTSW 4 148603040 missense possibly damaging 0.82
X0025:Masp2 UTSW 4 148602723 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAATTGGGTCCTAACAGCCGC -3'
(R):5'- TCCCACAAACCATCGCTGTGTC -3'

Sequencing Primer
(F):5'- CCGCTCATGCTGTATATGAGAAAAG -3'
(R):5'- GTCAGCAATTGGTATGTCCAC -3'
Posted On2014-04-24