Incidental Mutation 'R1630:Sgce'
ID172727
Institutional Source Beutler Lab
Gene Symbol Sgce
Ensembl Gene ENSMUSG00000004631
Gene Namesarcoglycan, epsilon
Synonymse-SG
MMRRC Submission 039667-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R1630 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location4674350-4747207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4719476 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 44 (V44M)
Ref Sequence ENSEMBL: ENSMUSP00000121964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004750] [ENSMUST00000090686] [ENSMUST00000101677] [ENSMUST00000115577] [ENSMUST00000115579] [ENSMUST00000126151] [ENSMUST00000133306]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004750
AA Change: V44M

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004750
Gene: ENSMUSG00000004631
AA Change: V44M

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090686
AA Change: V44M

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088185
Gene: ENSMUSG00000004631
AA Change: V44M

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101677
AA Change: V44M

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099200
Gene: ENSMUSG00000004631
AA Change: V44M

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115577
AA Change: V80M

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111240
Gene: ENSMUSG00000004631
AA Change: V80M

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
CADG 85 193 1.86e-10 SMART
low complexity region 457 468 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115579
AA Change: V44M

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111242
Gene: ENSMUSG00000004631
AA Change: V44M

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123907
SMART Domains Protein: ENSMUSP00000120910
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 32 140 1.86e-10 SMART
low complexity region 395 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126151
SMART Domains Protein: ENSMUSP00000120718
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 389 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128109
Predicted Effect probably damaging
Transcript: ENSMUST00000133306
AA Change: V44M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121964
Gene: ENSMUSG00000004631
AA Change: V44M

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 398 409 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153284
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the epsilon member of the sarcoglycan family. Sarcoglycans are transmembrane proteins that are components of the dystrophin-glycoprotein complex, which link the actin cytoskeleton to the extracellular matrix. Unlike other family members which are predominantly expressed in striated muscle, the epsilon sarcoglycan is more broadly expressed. Mutations in this gene are associated with myoclonus-dystonia syndrome. This gene is imprinted, with preferential expression from the paternal allele. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene associated with this gene is located on chromosome 2. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele display significantly increased myoclonus and deficits in motor coordination and balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429P17Rik C A 13: 47,960,725 noncoding transcript Het
9930012K11Rik T C 14: 70,157,180 E175G probably benign Het
A630091E08Rik A G 7: 98,543,607 noncoding transcript Het
Atm A T 9: 53,479,673 L1867Q probably damaging Het
Atp5a1 A G 18: 77,777,567 D63G possibly damaging Het
Baz2b A T 2: 60,006,130 S20T unknown Het
C1qtnf7 G A 5: 43,609,161 C34Y possibly damaging Het
Cactin A G 10: 81,323,725 T353A probably benign Het
Cdyl A G 13: 35,683,803 K21E possibly damaging Het
Crispld1 A G 1: 17,728,798 T48A probably benign Het
Csmd3 T A 15: 47,838,522 T1722S possibly damaging Het
Dapk1 A T 13: 60,729,531 E528V probably damaging Het
Dennd4a A G 9: 64,871,882 D549G probably benign Het
Dnajc5b C A 3: 19,574,741 N66K probably damaging Het
Dusp16 G T 6: 134,720,561 R250S probably damaging Het
F10 A G 8: 13,055,551 N384S probably benign Het
Gabrr2 A G 4: 33,085,647 S331G probably damaging Het
Gm12185 A C 11: 48,907,890 I592S probably benign Het
Gm9755 T C 8: 67,514,660 noncoding transcript Het
Hspg2 T C 4: 137,518,435 L913P probably damaging Het
Ifna1 T A 4: 88,850,329 S81R probably benign Het
Iqgap2 T C 13: 95,689,785 K510E probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,102,901 Y140H probably damaging Het
Lix1 A G 17: 17,457,158 H205R probably damaging Het
Masp2 A T 4: 148,614,033 T524S probably benign Het
Mndal A C 1: 173,874,392 F115V possibly damaging Het
Morc3 C A 16: 93,866,533 N541K probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Nes T A 3: 87,977,677 V1037E probably benign Het
Nfkbil1 A G 17: 35,221,164 W178R probably damaging Het
Nobox A T 6: 43,307,212 C8* probably null Het
Nwd1 A G 8: 72,667,029 T348A possibly damaging Het
Olfr1048 A G 2: 86,236,086 S243P probably damaging Het
Olfr1350 T C 7: 6,570,674 S228P probably damaging Het
Olfr382 T C 11: 73,516,720 T160A probably damaging Het
Osbp2 T C 11: 3,717,167 T448A probably benign Het
Plrg1 A G 3: 83,058,763 D75G probably benign Het
Ppp1r8 T C 4: 132,829,437 E213G probably benign Het
Rad54l2 A G 9: 106,703,629 F898L possibly damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl10a G C 11: 5,059,542 R110P probably damaging Het
Rttn T C 18: 89,042,954 I1082T probably benign Het
Sema6d A G 2: 124,664,345 D734G possibly damaging Het
Sgo2b A G 8: 63,927,797 V667A possibly damaging Het
Shcbp1 A T 8: 4,748,763 C118* probably null Het
Slain2 C T 5: 72,976,004 P563S probably damaging Het
Slco1b2 A T 6: 141,656,821 I167F probably damaging Het
Speg T C 1: 75,422,977 L2356P probably damaging Het
Sptbn4 A G 7: 27,418,739 V305A probably benign Het
Sspo G A 6: 48,457,724 R1050H probably benign Het
Tmem106b A G 6: 13,081,541 N149S probably benign Het
Tmem200a T C 10: 25,992,914 T486A probably damaging Het
Tmem212 T A 3: 27,885,101 T79S possibly damaging Het
Ttll11 A G 2: 35,889,325 V471A probably damaging Het
Vill A G 9: 119,070,701 N318D probably benign Het
Vmn2r102 A G 17: 19,678,770 D458G possibly damaging Het
Zfp472 T A 17: 32,977,978 C342* probably null Het
Zfp963 A T 8: 69,744,187 probably benign Het
Other mutations in Sgce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Sgce APN 6 4689750 missense probably damaging 1.00
IGL01399:Sgce APN 6 4746997 missense probably damaging 1.00
IGL01796:Sgce APN 6 4711326 missense probably damaging 1.00
IGL02403:Sgce APN 6 4694059 missense probably damaging 1.00
IGL02421:Sgce APN 6 4694187 splice site probably benign
IGL02547:Sgce APN 6 4711301 splice site probably benign
IGL02585:Sgce APN 6 4711388 splice site probably benign
IGL03355:Sgce APN 6 4689738 missense probably damaging 1.00
IGL03374:Sgce APN 6 4689718 nonsense probably null
PIT4445001:Sgce UTSW 6 4689654 missense possibly damaging 0.85
R0345:Sgce UTSW 6 4718019 missense probably damaging 1.00
R0611:Sgce UTSW 6 4689621 missense probably damaging 1.00
R0719:Sgce UTSW 6 4689753 missense probably damaging 1.00
R1162:Sgce UTSW 6 4691419 splice site probably benign
R1694:Sgce UTSW 6 4689709 missense probably damaging 1.00
R1759:Sgce UTSW 6 4689765 missense probably damaging 1.00
R1897:Sgce UTSW 6 4691511 missense probably benign 0.00
R2231:Sgce UTSW 6 4730066 missense probably benign 0.44
R3429:Sgce UTSW 6 4730008 missense probably benign 0.01
R4011:Sgce UTSW 6 4691563 nonsense probably null
R4426:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4427:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4651:Sgce UTSW 6 4689560 intron probably benign
R4652:Sgce UTSW 6 4689560 intron probably benign
R4921:Sgce UTSW 6 4694153 missense probably damaging 1.00
R4974:Sgce UTSW 6 4689630 missense probably benign 0.00
R6271:Sgce UTSW 6 4730015 missense possibly damaging 0.81
R6898:Sgce UTSW 6 4689666 missense probably damaging 1.00
R7317:Sgce UTSW 6 4691615 missense probably benign 0.00
R7347:Sgce UTSW 6 4694106 missense probably damaging 1.00
R7512:Sgce UTSW 6 4707192 missense possibly damaging 0.75
R7671:Sgce UTSW 6 4691564 missense probably damaging 1.00
R8009:Sgce UTSW 6 4691636 missense probably damaging 0.99
X0026:Sgce UTSW 6 4689638 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CAGGCAGCAATGTTAACTGTCAACAC -3'
(R):5'- TCCAGCAAATATGCACTAACGGTTCTC -3'

Sequencing Primer
(F):5'- TGTTAACTGTCAACACTAAACTCC -3'
(R):5'- CACTAACGGTTCTCTGGTGTG -3'
Posted On2014-04-24