Incidental Mutation 'R1630:Nobox'
ID172729
Institutional Source Beutler Lab
Gene Symbol Nobox
Ensembl Gene ENSMUSG00000029736
Gene NameNOBOX oogenesis homeobox
SynonymsOg2x
MMRRC Submission 039667-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R1630 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location43303674-43309554 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 43307212 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 8 (C8*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031749]
Predicted Effect probably null
Transcript: ENSMUST00000031749
AA Change: C133*
SMART Domains Protein: ENSMUSP00000031749
Gene: ENSMUSG00000029736
AA Change: C133*

DomainStartEndE-ValueType
HOX 136 198 5.04e-23 SMART
low complexity region 364 384 N/A INTRINSIC
low complexity region 389 403 N/A INTRINSIC
low complexity region 408 420 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172554
AA Change: C8*
SMART Domains Protein: ENSMUSP00000133353
Gene: ENSMUSG00000029736
AA Change: C8*

DomainStartEndE-ValueType
Pfam:Homeobox 1 22 4e-7 PFAM
low complexity region 161 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183706
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This homeobox gene encodes a transcription factor that is thought to play a role in oogenesis. In mice, it is essential for folliculogenesis and regulation of oocyte-specific genes. Defects in this gene result in premature ovarian failure type 5.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display oocyte degeneration after birth, atrophic ovaries, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429P17Rik C A 13: 47,960,725 noncoding transcript Het
9930012K11Rik T C 14: 70,157,180 E175G probably benign Het
A630091E08Rik A G 7: 98,543,607 noncoding transcript Het
Atm A T 9: 53,479,673 L1867Q probably damaging Het
Atp5a1 A G 18: 77,777,567 D63G possibly damaging Het
Baz2b A T 2: 60,006,130 S20T unknown Het
C1qtnf7 G A 5: 43,609,161 C34Y possibly damaging Het
Cactin A G 10: 81,323,725 T353A probably benign Het
Cdyl A G 13: 35,683,803 K21E possibly damaging Het
Crispld1 A G 1: 17,728,798 T48A probably benign Het
Csmd3 T A 15: 47,838,522 T1722S possibly damaging Het
Dapk1 A T 13: 60,729,531 E528V probably damaging Het
Dennd4a A G 9: 64,871,882 D549G probably benign Het
Dnajc5b C A 3: 19,574,741 N66K probably damaging Het
Dusp16 G T 6: 134,720,561 R250S probably damaging Het
F10 A G 8: 13,055,551 N384S probably benign Het
Gabrr2 A G 4: 33,085,647 S331G probably damaging Het
Gm12185 A C 11: 48,907,890 I592S probably benign Het
Gm9755 T C 8: 67,514,660 noncoding transcript Het
Hspg2 T C 4: 137,518,435 L913P probably damaging Het
Ifna1 T A 4: 88,850,329 S81R probably benign Het
Iqgap2 T C 13: 95,689,785 K510E probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,102,901 Y140H probably damaging Het
Lix1 A G 17: 17,457,158 H205R probably damaging Het
Masp2 A T 4: 148,614,033 T524S probably benign Het
Mndal A C 1: 173,874,392 F115V possibly damaging Het
Morc3 C A 16: 93,866,533 N541K probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Nes T A 3: 87,977,677 V1037E probably benign Het
Nfkbil1 A G 17: 35,221,164 W178R probably damaging Het
Nwd1 A G 8: 72,667,029 T348A possibly damaging Het
Olfr1048 A G 2: 86,236,086 S243P probably damaging Het
Olfr1350 T C 7: 6,570,674 S228P probably damaging Het
Olfr382 T C 11: 73,516,720 T160A probably damaging Het
Osbp2 T C 11: 3,717,167 T448A probably benign Het
Plrg1 A G 3: 83,058,763 D75G probably benign Het
Ppp1r8 T C 4: 132,829,437 E213G probably benign Het
Rad54l2 A G 9: 106,703,629 F898L possibly damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl10a G C 11: 5,059,542 R110P probably damaging Het
Rttn T C 18: 89,042,954 I1082T probably benign Het
Sema6d A G 2: 124,664,345 D734G possibly damaging Het
Sgce C T 6: 4,719,476 V44M probably damaging Het
Sgo2b A G 8: 63,927,797 V667A possibly damaging Het
Shcbp1 A T 8: 4,748,763 C118* probably null Het
Slain2 C T 5: 72,976,004 P563S probably damaging Het
Slco1b2 A T 6: 141,656,821 I167F probably damaging Het
Speg T C 1: 75,422,977 L2356P probably damaging Het
Sptbn4 A G 7: 27,418,739 V305A probably benign Het
Sspo G A 6: 48,457,724 R1050H probably benign Het
Tmem106b A G 6: 13,081,541 N149S probably benign Het
Tmem200a T C 10: 25,992,914 T486A probably damaging Het
Tmem212 T A 3: 27,885,101 T79S possibly damaging Het
Ttll11 A G 2: 35,889,325 V471A probably damaging Het
Vill A G 9: 119,070,701 N318D probably benign Het
Vmn2r102 A G 17: 19,678,770 D458G possibly damaging Het
Zfp472 T A 17: 32,977,978 C342* probably null Het
Zfp963 A T 8: 69,744,187 probably benign Het
Other mutations in Nobox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Nobox APN 6 43304001 missense possibly damaging 0.85
IGL01399:Nobox APN 6 43304038 missense probably benign 0.06
IGL01523:Nobox APN 6 43304123 missense probably damaging 0.96
IGL01762:Nobox APN 6 43303993 missense probably damaging 0.96
IGL02007:Nobox APN 6 43307538 missense probably damaging 0.99
IGL02582:Nobox APN 6 43305039 missense possibly damaging 0.53
IGL02733:Nobox APN 6 43307202 missense possibly damaging 0.95
IGL02902:Nobox APN 6 43305683 missense probably benign 0.12
IGL02988:Nobox UTSW 6 43305161 missense possibly damaging 0.79
R0056:Nobox UTSW 6 43304919 missense probably benign 0.23
R0418:Nobox UTSW 6 43307235 missense probably null
R0699:Nobox UTSW 6 43307210 missense probably benign 0.11
R1387:Nobox UTSW 6 43307198 missense probably damaging 1.00
R1619:Nobox UTSW 6 43307467 missense possibly damaging 0.86
R2184:Nobox UTSW 6 43304885 missense possibly damaging 0.72
R2760:Nobox UTSW 6 43304106 missense probably damaging 0.99
R3752:Nobox UTSW 6 43307233 missense probably damaging 0.96
R4273:Nobox UTSW 6 43306008 missense probably benign 0.12
R4790:Nobox UTSW 6 43305546 missense probably benign 0.12
R4805:Nobox UTSW 6 43305119 missense probably damaging 0.99
R6109:Nobox UTSW 6 43305169 missense probably damaging 0.98
R6759:Nobox UTSW 6 43307604 missense possibly damaging 0.70
R7761:Nobox UTSW 6 43304191 nonsense probably null
R8084:Nobox UTSW 6 43305167 missense possibly damaging 0.92
R8113:Nobox UTSW 6 43306017 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GGTCTTCCCTTCAGGGGTCAAAAG -3'
(R):5'- GCCCATCCAGGATGATCAAGACAAG -3'

Sequencing Primer
(F):5'- CCCTTCAGGGGTCAAAAGTATTG -3'
(R):5'- GTTGTTCTCCCCCAGAGAGAAAG -3'
Posted On2014-04-24