Incidental Mutation 'R1630:Dusp16'
ID 172731
Institutional Source Beutler Lab
Gene Symbol Dusp16
Ensembl Gene ENSMUSG00000030203
Gene Name dual specificity phosphatase 16
Synonyms 3830417M17Rik, D6Ertd213e, MKP7, MKP-7
MMRRC Submission 039667-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock # R1630 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 134715468-134792625 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 134720561 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 250 (R250S)
Ref Sequence ENSEMBL: ENSMUSP00000115925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100857] [ENSMUST00000129433] [ENSMUST00000204083]
AlphaFold Q6PCP3
Predicted Effect probably damaging
Transcript: ENSMUST00000100857
AA Change: R250S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098419
Gene: ENSMUSG00000030203
AA Change: R250S

DomainStartEndE-ValueType
RHOD 12 134 5.58e-16 SMART
DSPc 158 297 1.66e-68 SMART
Blast:DSPc 576 621 9e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000129433
AA Change: R250S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115925
Gene: ENSMUSG00000030203
AA Change: R250S

DomainStartEndE-ValueType
Blast:RHOD 1 67 8e-41 BLAST
PDB:2VSW|B 1 83 1e-52 PDB
DSPc 91 232 3.73e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203651
Predicted Effect probably benign
Transcript: ENSMUST00000204083
SMART Domains Protein: ENSMUSP00000144834
Gene: ENSMUSG00000030203

DomainStartEndE-ValueType
RHOD 12 124 1.5e-8 SMART
Meta Mutation Damage Score 0.9077 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitogen-activated protein kinase phosphatase that is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. The encoded protein specifically regulates the c-Jun amino-terminal kinase (JNK) and extracellular signal-regulated kinase (ERK) pathways.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality and decreased birth weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429P17Rik C A 13: 47,960,725 noncoding transcript Het
9930012K11Rik T C 14: 70,157,180 E175G probably benign Het
A630091E08Rik A G 7: 98,543,607 noncoding transcript Het
Atm A T 9: 53,479,673 L1867Q probably damaging Het
Atp5a1 A G 18: 77,777,567 D63G possibly damaging Het
Baz2b A T 2: 60,006,130 S20T unknown Het
C1qtnf7 G A 5: 43,609,161 C34Y possibly damaging Het
Cactin A G 10: 81,323,725 T353A probably benign Het
Cdyl A G 13: 35,683,803 K21E possibly damaging Het
Crispld1 A G 1: 17,728,798 T48A probably benign Het
Csmd3 T A 15: 47,838,522 T1722S possibly damaging Het
Dapk1 A T 13: 60,729,531 E528V probably damaging Het
Dennd4a A G 9: 64,871,882 D549G probably benign Het
Dnajc5b C A 3: 19,574,741 N66K probably damaging Het
F10 A G 8: 13,055,551 N384S probably benign Het
Gabrr2 A G 4: 33,085,647 S331G probably damaging Het
Gm12185 A C 11: 48,907,890 I592S probably benign Het
Gm9755 T C 8: 67,514,660 noncoding transcript Het
Hspg2 T C 4: 137,518,435 L913P probably damaging Het
Ifna1 T A 4: 88,850,329 S81R probably benign Het
Iqgap2 T C 13: 95,689,785 K510E probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,102,901 Y140H probably damaging Het
Lix1 A G 17: 17,457,158 H205R probably damaging Het
Masp2 A T 4: 148,614,033 T524S probably benign Het
Mndal A C 1: 173,874,392 F115V possibly damaging Het
Morc3 C A 16: 93,866,533 N541K probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Nes T A 3: 87,977,677 V1037E probably benign Het
Nfkbil1 A G 17: 35,221,164 W178R probably damaging Het
Nobox A T 6: 43,307,212 C8* probably null Het
Nwd1 A G 8: 72,667,029 T348A possibly damaging Het
Olfr1048 A G 2: 86,236,086 S243P probably damaging Het
Olfr1350 T C 7: 6,570,674 S228P probably damaging Het
Olfr382 T C 11: 73,516,720 T160A probably damaging Het
Osbp2 T C 11: 3,717,167 T448A probably benign Het
Plrg1 A G 3: 83,058,763 D75G probably benign Het
Ppp1r8 T C 4: 132,829,437 E213G probably benign Het
Rad54l2 A G 9: 106,703,629 F898L possibly damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl10a G C 11: 5,059,542 R110P probably damaging Het
Rttn T C 18: 89,042,954 I1082T probably benign Het
Sema6d A G 2: 124,664,345 D734G possibly damaging Het
Sgce C T 6: 4,719,476 V44M probably damaging Het
Sgo2b A G 8: 63,927,797 V667A possibly damaging Het
Shcbp1 A T 8: 4,748,763 C118* probably null Het
Slain2 C T 5: 72,976,004 P563S probably damaging Het
Slco1b2 A T 6: 141,656,821 I167F probably damaging Het
Speg T C 1: 75,422,977 L2356P probably damaging Het
Sptbn4 A G 7: 27,418,739 V305A probably benign Het
Sspo G A 6: 48,457,724 R1050H probably benign Het
Tmem106b A G 6: 13,081,541 N149S probably benign Het
Tmem200a T C 10: 25,992,914 T486A probably damaging Het
Tmem212 T A 3: 27,885,101 T79S possibly damaging Het
Ttll11 A G 2: 35,889,325 V471A probably damaging Het
Vill A G 9: 119,070,701 N318D probably benign Het
Vmn2r102 A G 17: 19,678,770 D458G possibly damaging Het
Zfp472 T A 17: 32,977,978 C342* probably null Het
Zfp963 A T 8: 69,744,187 probably benign Het
Other mutations in Dusp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Dusp16 APN 6 134725949 missense probably benign 0.13
IGL01305:Dusp16 APN 6 134718861 missense probably benign 0.03
IGL01331:Dusp16 APN 6 134718104 missense possibly damaging 0.53
IGL02535:Dusp16 APN 6 134718827 missense probably benign
IGL02606:Dusp16 APN 6 134761036 missense probably damaging 0.96
IGL02696:Dusp16 APN 6 134718435 missense probably damaging 0.99
ANU22:Dusp16 UTSW 6 134718861 missense probably benign 0.03
PIT4469001:Dusp16 UTSW 6 134761152 unclassified probably benign
PIT4504001:Dusp16 UTSW 6 134739883 missense possibly damaging 0.90
R0492:Dusp16 UTSW 6 134718402 missense probably benign
R0578:Dusp16 UTSW 6 134718321 missense probably damaging 1.00
R1962:Dusp16 UTSW 6 134718136 nonsense probably null
R2004:Dusp16 UTSW 6 134718839 missense probably benign
R3690:Dusp16 UTSW 6 134761119 unclassified probably benign
R3730:Dusp16 UTSW 6 134718861 missense probably benign
R5778:Dusp16 UTSW 6 134718314 missense probably benign 0.01
R6267:Dusp16 UTSW 6 134720493 critical splice donor site probably null
R6296:Dusp16 UTSW 6 134720493 critical splice donor site probably null
R6860:Dusp16 UTSW 6 134725879 nonsense probably null
R7248:Dusp16 UTSW 6 134718977 missense probably benign 0.01
R7645:Dusp16 UTSW 6 134725925 missense probably damaging 0.97
R8108:Dusp16 UTSW 6 134739873 missense probably benign
R8743:Dusp16 UTSW 6 134717970 missense probably benign 0.35
R8824:Dusp16 UTSW 6 134739769 missense probably benign
R8934:Dusp16 UTSW 6 134741676 intron probably benign
R9328:Dusp16 UTSW 6 134739939 missense probably damaging 1.00
R9364:Dusp16 UTSW 6 134719019 missense probably damaging 1.00
R9430:Dusp16 UTSW 6 134760866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAGAGCCAACTCTTCCTCAGTC -3'
(R):5'- AAGTTTCAGGTGAAGACACCGACAG -3'

Sequencing Primer
(F):5'- TCACCAGGAACCTGTGATGTG -3'
(R):5'- CGACAGTAACACTCAGAGTAATG -3'
Posted On 2014-04-24