Incidental Mutation 'R1630:Rapgef6'
ID172751
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene NameRap guanine nucleotide exchange factor (GEF) 6
SynonymsPDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 039667-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1630 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location54522847-54699285 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TG to TGG at 54546397 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108895] [ENSMUST00000207429]
Predicted Effect probably null
Transcript: ENSMUST00000101206
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102743
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108895
SMART Domains Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.95e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 526 1.03e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155132
Predicted Effect probably null
Transcript: ENSMUST00000207429
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429P17Rik C A 13: 47,960,725 noncoding transcript Het
9930012K11Rik T C 14: 70,157,180 E175G probably benign Het
A630091E08Rik A G 7: 98,543,607 noncoding transcript Het
Atm A T 9: 53,479,673 L1867Q probably damaging Het
Atp5a1 A G 18: 77,777,567 D63G possibly damaging Het
Baz2b A T 2: 60,006,130 S20T unknown Het
C1qtnf7 G A 5: 43,609,161 C34Y possibly damaging Het
Cactin A G 10: 81,323,725 T353A probably benign Het
Cdyl A G 13: 35,683,803 K21E possibly damaging Het
Crispld1 A G 1: 17,728,798 T48A probably benign Het
Csmd3 T A 15: 47,838,522 T1722S possibly damaging Het
Dapk1 A T 13: 60,729,531 E528V probably damaging Het
Dennd4a A G 9: 64,871,882 D549G probably benign Het
Dnajc5b C A 3: 19,574,741 N66K probably damaging Het
Dusp16 G T 6: 134,720,561 R250S probably damaging Het
F10 A G 8: 13,055,551 N384S probably benign Het
Gabrr2 A G 4: 33,085,647 S331G probably damaging Het
Gm12185 A C 11: 48,907,890 I592S probably benign Het
Gm9755 T C 8: 67,514,660 noncoding transcript Het
Hspg2 T C 4: 137,518,435 L913P probably damaging Het
Ifna1 T A 4: 88,850,329 S81R probably benign Het
Iqgap2 T C 13: 95,689,785 K510E probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,102,901 Y140H probably damaging Het
Lix1 A G 17: 17,457,158 H205R probably damaging Het
Masp2 A T 4: 148,614,033 T524S probably benign Het
Mndal A C 1: 173,874,392 F115V possibly damaging Het
Morc3 C A 16: 93,866,533 N541K probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Nes T A 3: 87,977,677 V1037E probably benign Het
Nfkbil1 A G 17: 35,221,164 W178R probably damaging Het
Nobox A T 6: 43,307,212 C8* probably null Het
Nwd1 A G 8: 72,667,029 T348A possibly damaging Het
Olfr1048 A G 2: 86,236,086 S243P probably damaging Het
Olfr1350 T C 7: 6,570,674 S228P probably damaging Het
Olfr382 T C 11: 73,516,720 T160A probably damaging Het
Osbp2 T C 11: 3,717,167 T448A probably benign Het
Plrg1 A G 3: 83,058,763 D75G probably benign Het
Ppp1r8 T C 4: 132,829,437 E213G probably benign Het
Rad54l2 A G 9: 106,703,629 F898L possibly damaging Het
Rasl10a G C 11: 5,059,542 R110P probably damaging Het
Rttn T C 18: 89,042,954 I1082T probably benign Het
Sema6d A G 2: 124,664,345 D734G possibly damaging Het
Sgce C T 6: 4,719,476 V44M probably damaging Het
Sgo2b A G 8: 63,927,797 V667A possibly damaging Het
Shcbp1 A T 8: 4,748,763 C118* probably null Het
Slain2 C T 5: 72,976,004 P563S probably damaging Het
Slco1b2 A T 6: 141,656,821 I167F probably damaging Het
Speg T C 1: 75,422,977 L2356P probably damaging Het
Sptbn4 A G 7: 27,418,739 V305A probably benign Het
Sspo G A 6: 48,457,724 R1050H probably benign Het
Tmem106b A G 6: 13,081,541 N149S probably benign Het
Tmem200a T C 10: 25,992,914 T486A probably damaging Het
Tmem212 T A 3: 27,885,101 T79S possibly damaging Het
Ttll11 A G 2: 35,889,325 V471A probably damaging Het
Vill A G 9: 119,070,701 N318D probably benign Het
Vmn2r102 A G 17: 19,678,770 D458G possibly damaging Het
Zfp472 T A 17: 32,977,978 C342* probably null Het
Zfp963 A T 8: 69,744,187 probably benign Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 intron probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 intron probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
R7646:Rapgef6 UTSW 11 54625954 missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54661075 missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54626588 missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54694399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCTCAATCCACCTGCATATGG -3'
(R):5'- AAGCCAGTGTCTTTAGCAACAGTAGTC -3'

Sequencing Primer
(F):5'- CAGGCATAGGCCACTATGACTG -3'
(R):5'- GCACGAAACTGTTTCCTATGT -3'
Posted On2014-04-24