Incidental Mutation 'R1630:Myocd'
ID172752
Institutional Source Beutler Lab
Gene Symbol Myocd
Ensembl Gene ENSMUSG00000020542
Gene Namemyocardin
SynonymsSrfcp
MMRRC Submission 039667-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1630 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location65176561-65269989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65196394 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 236 (S236P)
Ref Sequence ENSEMBL: ENSMUSP00000104335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101042] [ENSMUST00000102635] [ENSMUST00000108695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101042
AA Change: S108P

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542
AA Change: S108P

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102635
AA Change: S236P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099695
Gene: ENSMUSG00000020542
AA Change: S236P

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 4e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108695
AA Change: S236P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104335
Gene: ENSMUSG00000020542
AA Change: S236P

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 5e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 743 757 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144399
AA Change: S110P
SMART Domains Protein: ENSMUSP00000115572
Gene: ENSMUSG00000020542
AA Change: S110P

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 160 195 N/A INTRINSIC
Meta Mutation Damage Score 0.0955 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is expressed in heart, aorta, and in smooth muscle cell-containing tissues. It functions as a transcriptional co-activator of serum response factor (SRF) and modulates expression of cardiac and smooth muscle-specific SRF-target genes, and thus may play a crucial role in cardiogenesis and differentiation of the smooth muscle cell lineage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality and fail to form vascular smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429P17Rik C A 13: 47,960,725 noncoding transcript Het
9930012K11Rik T C 14: 70,157,180 E175G probably benign Het
A630091E08Rik A G 7: 98,543,607 noncoding transcript Het
Atm A T 9: 53,479,673 L1867Q probably damaging Het
Atp5a1 A G 18: 77,777,567 D63G possibly damaging Het
Baz2b A T 2: 60,006,130 S20T unknown Het
C1qtnf7 G A 5: 43,609,161 C34Y possibly damaging Het
Cactin A G 10: 81,323,725 T353A probably benign Het
Cdyl A G 13: 35,683,803 K21E possibly damaging Het
Crispld1 A G 1: 17,728,798 T48A probably benign Het
Csmd3 T A 15: 47,838,522 T1722S possibly damaging Het
Dapk1 A T 13: 60,729,531 E528V probably damaging Het
Dennd4a A G 9: 64,871,882 D549G probably benign Het
Dnajc5b C A 3: 19,574,741 N66K probably damaging Het
Dusp16 G T 6: 134,720,561 R250S probably damaging Het
F10 A G 8: 13,055,551 N384S probably benign Het
Gabrr2 A G 4: 33,085,647 S331G probably damaging Het
Gm12185 A C 11: 48,907,890 I592S probably benign Het
Gm9755 T C 8: 67,514,660 noncoding transcript Het
Hspg2 T C 4: 137,518,435 L913P probably damaging Het
Ifna1 T A 4: 88,850,329 S81R probably benign Het
Iqgap2 T C 13: 95,689,785 K510E probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,102,901 Y140H probably damaging Het
Lix1 A G 17: 17,457,158 H205R probably damaging Het
Masp2 A T 4: 148,614,033 T524S probably benign Het
Mndal A C 1: 173,874,392 F115V possibly damaging Het
Morc3 C A 16: 93,866,533 N541K probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nes T A 3: 87,977,677 V1037E probably benign Het
Nfkbil1 A G 17: 35,221,164 W178R probably damaging Het
Nobox A T 6: 43,307,212 C8* probably null Het
Nwd1 A G 8: 72,667,029 T348A possibly damaging Het
Olfr1048 A G 2: 86,236,086 S243P probably damaging Het
Olfr1350 T C 7: 6,570,674 S228P probably damaging Het
Olfr382 T C 11: 73,516,720 T160A probably damaging Het
Osbp2 T C 11: 3,717,167 T448A probably benign Het
Plrg1 A G 3: 83,058,763 D75G probably benign Het
Ppp1r8 T C 4: 132,829,437 E213G probably benign Het
Rad54l2 A G 9: 106,703,629 F898L possibly damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl10a G C 11: 5,059,542 R110P probably damaging Het
Rttn T C 18: 89,042,954 I1082T probably benign Het
Sema6d A G 2: 124,664,345 D734G possibly damaging Het
Sgce C T 6: 4,719,476 V44M probably damaging Het
Sgo2b A G 8: 63,927,797 V667A possibly damaging Het
Shcbp1 A T 8: 4,748,763 C118* probably null Het
Slain2 C T 5: 72,976,004 P563S probably damaging Het
Slco1b2 A T 6: 141,656,821 I167F probably damaging Het
Speg T C 1: 75,422,977 L2356P probably damaging Het
Sptbn4 A G 7: 27,418,739 V305A probably benign Het
Sspo G A 6: 48,457,724 R1050H probably benign Het
Tmem106b A G 6: 13,081,541 N149S probably benign Het
Tmem200a T C 10: 25,992,914 T486A probably damaging Het
Tmem212 T A 3: 27,885,101 T79S possibly damaging Het
Ttll11 A G 2: 35,889,325 V471A probably damaging Het
Vill A G 9: 119,070,701 N318D probably benign Het
Vmn2r102 A G 17: 19,678,770 D458G possibly damaging Het
Zfp472 T A 17: 32,977,978 C342* probably null Het
Zfp963 A T 8: 69,744,187 probably benign Het
Other mutations in Myocd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Myocd APN 11 65180944 critical splice acceptor site probably null
IGL00481:Myocd APN 11 65187154 missense probably damaging 0.99
IGL00857:Myocd APN 11 65178836 missense possibly damaging 0.93
IGL01012:Myocd APN 11 65184625 missense possibly damaging 0.51
IGL01570:Myocd APN 11 65200807 missense probably benign 0.00
IGL01865:Myocd APN 11 65200897 missense probably benign 0.30
IGL01938:Myocd APN 11 65187088 missense probably damaging 1.00
IGL02324:Myocd APN 11 65178658 missense probably benign 0.01
IGL02598:Myocd APN 11 65183470 missense probably benign 0.31
IGL02886:Myocd APN 11 65178743 missense probably damaging 0.99
IGL03008:Myocd APN 11 65187566 missense probably damaging 0.98
IGL03034:Myocd APN 11 65218685 missense probably benign 0.00
harvey UTSW 11 65179030 splice site probably null
irma UTSW 11 65196394 missense probably damaging 0.97
Nate UTSW 11 65233088 splice site probably null
R0078:Myocd UTSW 11 65187464 missense possibly damaging 0.96
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0453:Myocd UTSW 11 65196225 missense probably damaging 1.00
R0523:Myocd UTSW 11 65180902 missense probably damaging 1.00
R0838:Myocd UTSW 11 65178932 missense probably benign 0.00
R0899:Myocd UTSW 11 65195192 missense possibly damaging 0.50
R1167:Myocd UTSW 11 65196377 missense possibly damaging 0.77
R1472:Myocd UTSW 11 65187504 missense probably benign 0.01
R1508:Myocd UTSW 11 65184516 missense probably damaging 0.98
R1620:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1731:Myocd UTSW 11 65200888 missense probably benign 0.30
R1740:Myocd UTSW 11 65218521 splice site probably benign
R1769:Myocd UTSW 11 65178701 missense probably benign 0.01
R1823:Myocd UTSW 11 65178670 missense probably benign 0.00
R1968:Myocd UTSW 11 65200907 missense probably damaging 1.00
R1997:Myocd UTSW 11 65204321 nonsense probably null
R2018:Myocd UTSW 11 65187028 missense probably damaging 1.00
R2105:Myocd UTSW 11 65218658 nonsense probably null
R2314:Myocd UTSW 11 65200807 missense probably damaging 1.00
R4330:Myocd UTSW 11 65223764 missense probably benign 0.12
R4331:Myocd UTSW 11 65223764 missense probably benign 0.12
R4603:Myocd UTSW 11 65187745 missense possibly damaging 0.82
R4619:Myocd UTSW 11 65178428 utr 3 prime probably benign
R4631:Myocd UTSW 11 65178859 missense probably benign 0.10
R4865:Myocd UTSW 11 65179030 splice site probably null
R4974:Myocd UTSW 11 65183473 missense possibly damaging 0.78
R4976:Myocd UTSW 11 65222050 missense probably benign 0.00
R5478:Myocd UTSW 11 65233088 splice site probably null
R5499:Myocd UTSW 11 65178749 missense possibly damaging 0.62
R6052:Myocd UTSW 11 65196256 missense probably damaging 1.00
R6356:Myocd UTSW 11 65218570 splice site probably null
R7144:Myocd UTSW 11 65218648 missense probably damaging 1.00
R7261:Myocd UTSW 11 65187596 missense probably damaging 0.98
R7354:Myocd UTSW 11 65187493 missense probably benign 0.00
R7461:Myocd UTSW 11 65218603 missense probably damaging 1.00
R7613:Myocd UTSW 11 65218603 missense probably damaging 1.00
R7718:Myocd UTSW 11 65218626 missense probably damaging 1.00
R7956:Myocd UTSW 11 65269668 missense possibly damaging 0.50
R8345:Myocd UTSW 11 65187132 nonsense probably null
X0057:Myocd UTSW 11 65183445 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGGAGTCAGAGGCCAAACATATCAC -3'
(R):5'- TCCAAGAGCCCAGTAAGGTGTAAGG -3'

Sequencing Primer
(F):5'- tgctgctgctgctgttg -3'
(R):5'- GTGCCTATGTGCCGTGAG -3'
Posted On2014-04-24