Incidental Mutation 'R1630:Mslnl'
ID 172763
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Name mesothelin-like
Synonyms
MMRRC Submission 039667-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1630 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 25736040-25748330 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25742934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 128 (V128M)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
AlphaFold Q8C160
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: V128M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: V128M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.2148 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429P17Rik C A 13: 47,960,725 noncoding transcript Het
9930012K11Rik T C 14: 70,157,180 E175G probably benign Het
A630091E08Rik A G 7: 98,543,607 noncoding transcript Het
Atm A T 9: 53,479,673 L1867Q probably damaging Het
Atp5a1 A G 18: 77,777,567 D63G possibly damaging Het
Baz2b A T 2: 60,006,130 S20T unknown Het
C1qtnf7 G A 5: 43,609,161 C34Y possibly damaging Het
Cactin A G 10: 81,323,725 T353A probably benign Het
Cdyl A G 13: 35,683,803 K21E possibly damaging Het
Crispld1 A G 1: 17,728,798 T48A probably benign Het
Csmd3 T A 15: 47,838,522 T1722S possibly damaging Het
Dapk1 A T 13: 60,729,531 E528V probably damaging Het
Dennd4a A G 9: 64,871,882 D549G probably benign Het
Dnajc5b C A 3: 19,574,741 N66K probably damaging Het
Dusp16 G T 6: 134,720,561 R250S probably damaging Het
F10 A G 8: 13,055,551 N384S probably benign Het
Gabrr2 A G 4: 33,085,647 S331G probably damaging Het
Gm12185 A C 11: 48,907,890 I592S probably benign Het
Gm9755 T C 8: 67,514,660 noncoding transcript Het
Hspg2 T C 4: 137,518,435 L913P probably damaging Het
Ifna1 T A 4: 88,850,329 S81R probably benign Het
Iqgap2 T C 13: 95,689,785 K510E probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,102,901 Y140H probably damaging Het
Lix1 A G 17: 17,457,158 H205R probably damaging Het
Masp2 A T 4: 148,614,033 T524S probably benign Het
Mndal A C 1: 173,874,392 F115V possibly damaging Het
Morc3 C A 16: 93,866,533 N541K probably benign Het
Myocd A G 11: 65,196,394 S236P probably benign Het
Nes T A 3: 87,977,677 V1037E probably benign Het
Nfkbil1 A G 17: 35,221,164 W178R probably damaging Het
Nobox A T 6: 43,307,212 C8* probably null Het
Nwd1 A G 8: 72,667,029 T348A possibly damaging Het
Olfr1048 A G 2: 86,236,086 S243P probably damaging Het
Olfr1350 T C 7: 6,570,674 S228P probably damaging Het
Olfr382 T C 11: 73,516,720 T160A probably damaging Het
Osbp2 T C 11: 3,717,167 T448A probably benign Het
Plrg1 A G 3: 83,058,763 D75G probably benign Het
Ppp1r8 T C 4: 132,829,437 E213G probably benign Het
Rad54l2 A G 9: 106,703,629 F898L possibly damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl10a G C 11: 5,059,542 R110P probably damaging Het
Rttn T C 18: 89,042,954 I1082T probably benign Het
Sema6d A G 2: 124,664,345 D734G possibly damaging Het
Sgce C T 6: 4,719,476 V44M probably damaging Het
Sgo2b A G 8: 63,927,797 V667A possibly damaging Het
Shcbp1 A T 8: 4,748,763 C118* probably null Het
Slain2 C T 5: 72,976,004 P563S probably damaging Het
Slco1b2 A T 6: 141,656,821 I167F probably damaging Het
Speg T C 1: 75,422,977 L2356P probably damaging Het
Sptbn4 A G 7: 27,418,739 V305A probably benign Het
Sspo G A 6: 48,457,724 R1050H probably benign Het
Tmem106b A G 6: 13,081,541 N149S probably benign Het
Tmem200a T C 10: 25,992,914 T486A probably damaging Het
Tmem212 T A 3: 27,885,101 T79S possibly damaging Het
Ttll11 A G 2: 35,889,325 V471A probably damaging Het
Vill A G 9: 119,070,701 N318D probably benign Het
Vmn2r102 A G 17: 19,678,770 D458G possibly damaging Het
Zfp472 T A 17: 32,977,978 C342* probably null Het
Zfp963 A T 8: 69,744,187 probably benign Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R0881:Mslnl UTSW 17 25742965 missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1296:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1850:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1914:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2284:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3546:Mslnl UTSW 17 25744969 missense probably damaging 0.98
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3729:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3894:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4562:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R6761:Mslnl UTSW 17 25746073 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
R7156:Mslnl UTSW 17 25743210 missense probably benign 0.20
R7467:Mslnl UTSW 17 25736921 start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25743183 missense probably damaging 0.97
R7807:Mslnl UTSW 17 25746777 missense probably benign 0.03
R8682:Mslnl UTSW 17 25746988 missense probably benign
R8735:Mslnl UTSW 17 25745088 missense probably benign 0.09
R8742:Mslnl UTSW 17 25745073 missense probably damaging 1.00
R9208:Mslnl UTSW 17 25742720 missense possibly damaging 0.94
R9264:Mslnl UTSW 17 25742532 intron probably benign
RF007:Mslnl UTSW 17 25743228 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTTTTCTACGAGTGAGTGCCCCTG -3'
(R):5'- GCAGTCACAATTTGTGCTGCCTCC -3'

Sequencing Primer
(F):5'- TGCCCCTGCCATCAGAAG -3'
(R):5'- TCTGAAGCACTGAGCTGTAGG -3'
Posted On 2014-04-24