Incidental Mutation 'R1631:Als2'
ID172771
Institutional Source Beutler Lab
Gene Symbol Als2
Ensembl Gene ENSMUSG00000026024
Gene Namealsin Rho guanine nucleotide exchange factor
Synonyms3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
MMRRC Submission 039668-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R1631 (G1)
Quality Score160
Status Not validated
Chromosome1
Chromosomal Location59162926-59237231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59218067 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 12 (E12G)
Ref Sequence ENSEMBL: ENSMUSP00000125753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027178] [ENSMUST00000160945] [ENSMUST00000163058]
Predicted Effect probably benign
Transcript: ENSMUST00000027178
AA Change: E12G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027178
Gene: ENSMUSG00000026024
AA Change: E12G

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 1.1e-9 PFAM
Pfam:RCC1 109 165 9.5e-11 PFAM
Pfam:RCC1 170 216 6.6e-11 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 5.4e-13 PFAM
Pfam:RCC1_2 555 584 8.3e-12 PFAM
Pfam:RCC1 571 619 3.4e-11 PFAM
Pfam:RhoGEF 688 877 6.5e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159166
Predicted Effect probably benign
Transcript: ENSMUST00000160945
SMART Domains Protein: ENSMUSP00000140990
Gene: ENSMUSG00000026024

DomainStartEndE-ValueType
Pfam:RCC1 1 52 3.3e-8 PFAM
Pfam:RCC1_2 39 66 4.1e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163058
AA Change: E12G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000125753
Gene: ENSMUSG00000026024
AA Change: E12G

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 9.9e-10 PFAM
Pfam:RCC1 109 165 9.5e-12 PFAM
Pfam:RCC1 170 216 4.9e-12 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 4.6e-14 PFAM
Pfam:RCC1_2 555 584 1.2e-11 PFAM
Pfam:RCC1 571 619 8.6e-11 PFAM
Pfam:RhoGEF 688 877 2.6e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188469
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mutations in this gene may result in increased body weight, altered endosome trafficking, modest motor behavioral abnormalities, altered anxiety responses, impaired axonal transport, and mild neurolopathogical deficits including axonal degeneration in the corticospinal tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik C A 13: 105,082,241 Q28K probably benign Het
Adamts10 T A 17: 33,537,342 S320T probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgef10 A T 8: 14,947,157 D321V probably damaging Het
Atp8a1 T G 5: 67,749,052 probably null Het
Avil A G 10: 127,010,625 probably null Het
C2cd3 G A 7: 100,372,497 probably null Het
Col18a1 G A 10: 77,059,297 P1177S probably damaging Het
Copb2 T A 9: 98,580,160 F428L probably benign Het
Cpa1 A G 6: 30,640,924 E138G probably damaging Het
Ctsm T C 13: 61,538,435 I12V possibly damaging Het
Dctn1 A G 6: 83,197,596 Q967R possibly damaging Het
Dok2 T C 14: 70,776,953 Y194H probably damaging Het
Ezh2 C T 6: 47,577,658 M1I probably null Het
Fkbp8 T A 8: 70,531,632 L210Q probably damaging Het
Fpr1 T A 17: 17,877,001 Q242L probably benign Het
Gal3st2b T A 1: 93,940,783 D243E probably damaging Het
Gm281 C T 14: 13,829,796 E649K probably damaging Het
Gm5422 A G 10: 31,249,806 noncoding transcript Het
Gucy1a2 A G 9: 3,533,052 N84D probably damaging Het
Hsd3b5 A C 3: 98,622,077 V79G probably damaging Het
Htr6 A T 4: 139,061,493 V417E probably benign Het
Ifnar2 G A 16: 91,391,867 V79I probably benign Het
Ighv10-1 T C 12: 114,479,482 probably benign Het
Itpr2 A G 6: 146,180,290 F182L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama3 A G 18: 12,407,494 Y285C probably damaging Het
Lamc2 C A 1: 153,158,934 V108L possibly damaging Het
Lrrc14b A G 13: 74,361,254 probably null Het
Magi3 T C 3: 104,051,177 T531A probably benign Het
Mapre2 A G 18: 23,832,954 Y32C probably damaging Het
Med1 C T 11: 98,155,626 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Olfr1351 A T 10: 79,017,405 I28L probably benign Het
Olfr191 G A 16: 59,086,045 T146I probably benign Het
Olfr516 A C 7: 108,845,857 L51R probably damaging Het
Olfr555 A G 7: 102,659,201 I127V probably damaging Het
Pde1b A G 15: 103,521,672 T143A probably damaging Het
Pkhd1 T C 1: 20,522,897 D1664G probably benign Het
Plod3 C T 5: 136,988,993 R208W probably damaging Het
Pstk G A 7: 131,384,542 A277T possibly damaging Het
Qrich1 T C 9: 108,534,485 V403A probably damaging Het
Rad21 C A 15: 51,970,040 V348F probably damaging Het
Sacs T A 14: 61,210,732 L3409* probably null Het
Setd4 T A 16: 93,593,248 K98* probably null Het
Skint5 A G 4: 113,483,926 V1385A probably benign Het
Stam C A 2: 14,146,248 S472* probably null Het
Stx2 A G 5: 128,992,225 F141L probably damaging Het
Tia1 A G 6: 86,420,348 D101G probably damaging Het
Ttc21a T A 9: 119,954,162 probably null Het
Usp34 T A 11: 23,460,651 N2700K probably damaging Het
Other mutations in Als2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Als2 APN 1 59169896 nonsense probably null
IGL00924:Als2 APN 1 59215862 missense probably benign 0.03
IGL00949:Als2 APN 1 59215572 missense probably damaging 1.00
IGL00950:Als2 APN 1 59215382 missense probably benign 0.01
IGL01090:Als2 APN 1 59215616 missense possibly damaging 0.81
IGL01116:Als2 APN 1 59186004 splice site probably benign
IGL02001:Als2 APN 1 59180188 splice site probably benign
IGL02075:Als2 APN 1 59207786 missense probably damaging 1.00
IGL02441:Als2 APN 1 59215472 missense probably damaging 0.98
IGL02728:Als2 APN 1 59196347 missense probably benign 0.00
IGL02740:Als2 APN 1 59169919 missense probably benign 0.01
IGL02885:Als2 APN 1 59167491 missense probably benign 0.30
IGL02896:Als2 APN 1 59183787 missense probably benign 0.17
IGL02978:Als2 APN 1 59215165 missense probably benign 0.32
IGL03032:Als2 APN 1 59216030 splice site probably benign
IGL03065:Als2 APN 1 59215872 missense probably benign
IGL03212:Als2 APN 1 59202926 missense probably benign 0.00
IGL03226:Als2 APN 1 59186520 missense probably benign 0.43
R0014:Als2 UTSW 1 59211388 missense possibly damaging 0.53
R0243:Als2 UTSW 1 59215387 missense probably benign
R0326:Als2 UTSW 1 59180583 missense probably damaging 1.00
R0376:Als2 UTSW 1 59215565 missense probably benign 0.00
R0605:Als2 UTSW 1 59168414 missense probably benign 0.02
R1607:Als2 UTSW 1 59180147 missense probably damaging 1.00
R1657:Als2 UTSW 1 59180601 missense probably damaging 1.00
R1763:Als2 UTSW 1 59174991 missense probably benign
R1950:Als2 UTSW 1 59185601 critical splice acceptor site probably null
R1970:Als2 UTSW 1 59215169 missense probably benign 0.34
R2151:Als2 UTSW 1 59207789 missense probably damaging 1.00
R2292:Als2 UTSW 1 59187385 missense probably damaging 1.00
R2513:Als2 UTSW 1 59215117 missense probably benign 0.00
R2849:Als2 UTSW 1 59206538 missense probably damaging 0.97
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2873:Als2 UTSW 1 59211137 missense probably damaging 1.00
R3054:Als2 UTSW 1 59215494 missense probably damaging 1.00
R3081:Als2 UTSW 1 59187349 missense probably damaging 1.00
R3176:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3276:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3801:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3803:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3808:Als2 UTSW 1 59170450 missense probably benign 0.08
R3884:Als2 UTSW 1 59185568 missense probably damaging 0.99
R4012:Als2 UTSW 1 59187416 missense probably benign 0.09
R4033:Als2 UTSW 1 59196241 missense probably benign
R4201:Als2 UTSW 1 59180154 missense possibly damaging 0.77
R4321:Als2 UTSW 1 59167454 splice site probably benign
R4707:Als2 UTSW 1 59215313 missense probably benign
R4784:Als2 UTSW 1 59215313 missense probably benign
R4785:Als2 UTSW 1 59215313 missense probably benign
R4991:Als2 UTSW 1 59207768 missense probably benign 0.10
R5068:Als2 UTSW 1 59211274 missense probably benign 0.13
R5110:Als2 UTSW 1 59185441 missense probably damaging 0.98
R5141:Als2 UTSW 1 59170452 missense possibly damaging 0.80
R5394:Als2 UTSW 1 59174946 missense probably benign 0.06
R5621:Als2 UTSW 1 59191890 missense probably benign 0.33
R5685:Als2 UTSW 1 59179091 missense possibly damaging 0.73
R5987:Als2 UTSW 1 59206587 missense probably damaging 1.00
R6012:Als2 UTSW 1 59185215 missense probably damaging 1.00
R6118:Als2 UTSW 1 59203069 missense possibly damaging 0.62
R6222:Als2 UTSW 1 59180125 missense probably benign 0.04
R6367:Als2 UTSW 1 59199140 missense probably benign 0.04
R6394:Als2 UTSW 1 59167197 missense probably damaging 0.99
R6866:Als2 UTSW 1 59211133 missense probably damaging 1.00
R6965:Als2 UTSW 1 59170557 missense possibly damaging 0.70
R7038:Als2 UTSW 1 59167514 missense possibly damaging 0.94
R7178:Als2 UTSW 1 59207812 missense probably damaging 0.96
R7494:Als2 UTSW 1 59183166 splice site probably null
R7541:Als2 UTSW 1 59167616 splice site probably null
R7601:Als2 UTSW 1 59170002 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGCAGTAGTCAGTAACCGTTGCCC -3'
(R):5'- AGAAGGTGCATAGCAAGTTGACCAC -3'

Sequencing Primer
(F):5'- AGTAACCGTTGCCCGACTTG -3'
(R):5'- TAGCAAGTTGACCACTTCCC -3'
Posted On2014-04-24