Incidental Mutation 'R1631:Lamc2'
ID172773
Institutional Source Beutler Lab
Gene Symbol Lamc2
Ensembl Gene ENSMUSG00000026479
Gene Namelaminin, gamma 2
Synonymsnicein, 100kDa
MMRRC Submission 039668-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R1631 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153122756-153186447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 153158934 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 108 (V108L)
Ref Sequence ENSEMBL: ENSMUSP00000140514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027753
AA Change: V108L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: V108L

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185356
AA Change: V108L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: V108L

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188831
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik C A 13: 105,082,241 Q28K probably benign Het
Adamts10 T A 17: 33,537,342 S320T probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Als2 T C 1: 59,218,067 E12G probably benign Het
Arhgef10 A T 8: 14,947,157 D321V probably damaging Het
Atp8a1 T G 5: 67,749,052 probably null Het
Avil A G 10: 127,010,625 probably null Het
C2cd3 G A 7: 100,372,497 probably null Het
Col18a1 G A 10: 77,059,297 P1177S probably damaging Het
Copb2 T A 9: 98,580,160 F428L probably benign Het
Cpa1 A G 6: 30,640,924 E138G probably damaging Het
Ctsm T C 13: 61,538,435 I12V possibly damaging Het
Dctn1 A G 6: 83,197,596 Q967R possibly damaging Het
Dok2 T C 14: 70,776,953 Y194H probably damaging Het
Ezh2 C T 6: 47,577,658 M1I probably null Het
Fkbp8 T A 8: 70,531,632 L210Q probably damaging Het
Fpr1 T A 17: 17,877,001 Q242L probably benign Het
Gal3st2b T A 1: 93,940,783 D243E probably damaging Het
Gm281 C T 14: 13,829,796 E649K probably damaging Het
Gm5422 A G 10: 31,249,806 noncoding transcript Het
Gucy1a2 A G 9: 3,533,052 N84D probably damaging Het
Hsd3b5 A C 3: 98,622,077 V79G probably damaging Het
Htr6 A T 4: 139,061,493 V417E probably benign Het
Ifnar2 G A 16: 91,391,867 V79I probably benign Het
Ighv10-1 T C 12: 114,479,482 probably benign Het
Itpr2 A G 6: 146,180,290 F182L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama3 A G 18: 12,407,494 Y285C probably damaging Het
Lrrc14b A G 13: 74,361,254 probably null Het
Magi3 T C 3: 104,051,177 T531A probably benign Het
Mapre2 A G 18: 23,832,954 Y32C probably damaging Het
Med1 C T 11: 98,155,626 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Olfr1351 A T 10: 79,017,405 I28L probably benign Het
Olfr191 G A 16: 59,086,045 T146I probably benign Het
Olfr516 A C 7: 108,845,857 L51R probably damaging Het
Olfr555 A G 7: 102,659,201 I127V probably damaging Het
Pde1b A G 15: 103,521,672 T143A probably damaging Het
Pkhd1 T C 1: 20,522,897 D1664G probably benign Het
Plod3 C T 5: 136,988,993 R208W probably damaging Het
Pstk G A 7: 131,384,542 A277T possibly damaging Het
Qrich1 T C 9: 108,534,485 V403A probably damaging Het
Rad21 C A 15: 51,970,040 V348F probably damaging Het
Sacs T A 14: 61,210,732 L3409* probably null Het
Setd4 T A 16: 93,593,248 K98* probably null Het
Skint5 A G 4: 113,483,926 V1385A probably benign Het
Stam C A 2: 14,146,248 S472* probably null Het
Stx2 A G 5: 128,992,225 F141L probably damaging Het
Tia1 A G 6: 86,420,348 D101G probably damaging Het
Ttc21a T A 9: 119,954,162 probably null Het
Usp34 T A 11: 23,460,651 N2700K probably damaging Het
Other mutations in Lamc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Lamc2 APN 1 153130056 missense probably benign 0.00
IGL00907:Lamc2 APN 1 153144651 missense probably benign 0.32
IGL02026:Lamc2 APN 1 153144736 splice site probably benign
IGL02335:Lamc2 APN 1 153166216 missense probably benign 0.00
IGL02568:Lamc2 APN 1 153166262 missense possibly damaging 0.91
IGL02640:Lamc2 APN 1 153152057 missense probably damaging 0.99
IGL02801:Lamc2 APN 1 153136783 missense probably benign 0.10
IGL02827:Lamc2 APN 1 153139781 missense probably damaging 1.00
IGL03240:Lamc2 APN 1 153124125 missense probably damaging 1.00
IGL03245:Lamc2 APN 1 153133757 splice site probably null
ANU74:Lamc2 UTSW 1 153131835 missense probably benign 0.00
R0279:Lamc2 UTSW 1 153130696 missense probably benign 0.01
R0528:Lamc2 UTSW 1 153124094 missense probably damaging 1.00
R0597:Lamc2 UTSW 1 153133621 missense probably benign 0.02
R0650:Lamc2 UTSW 1 153143876 missense possibly damaging 0.88
R0826:Lamc2 UTSW 1 153152082 missense probably damaging 1.00
R1015:Lamc2 UTSW 1 153166199 missense possibly damaging 0.53
R1172:Lamc2 UTSW 1 153166287 missense probably damaging 1.00
R1308:Lamc2 UTSW 1 153150818 missense probably damaging 1.00
R1521:Lamc2 UTSW 1 153166263 missense probably benign 0.11
R1525:Lamc2 UTSW 1 153130756 missense probably benign 0.00
R1602:Lamc2 UTSW 1 153127028 missense probably benign 0.00
R1633:Lamc2 UTSW 1 153141698 nonsense probably null
R1832:Lamc2 UTSW 1 153166187 missense possibly damaging 0.72
R1978:Lamc2 UTSW 1 153133597 critical splice donor site probably null
R1996:Lamc2 UTSW 1 153154470 missense possibly damaging 0.84
R2046:Lamc2 UTSW 1 153141765 missense probably benign 0.01
R2107:Lamc2 UTSW 1 153154386 splice site probably benign
R2130:Lamc2 UTSW 1 153127124 missense probably damaging 1.00
R2182:Lamc2 UTSW 1 153126866 missense possibly damaging 0.46
R2207:Lamc2 UTSW 1 153133706 missense possibly damaging 0.68
R2218:Lamc2 UTSW 1 153130779 missense probably benign 0.21
R3772:Lamc2 UTSW 1 153124251 missense probably benign
R4616:Lamc2 UTSW 1 153166169 missense probably damaging 1.00
R4874:Lamc2 UTSW 1 153154395 missense probably null 1.00
R4939:Lamc2 UTSW 1 153126836 missense probably damaging 1.00
R4985:Lamc2 UTSW 1 153136805 missense probably benign
R5544:Lamc2 UTSW 1 153124053 missense possibly damaging 0.93
R5632:Lamc2 UTSW 1 153131890 missense probably damaging 1.00
R5771:Lamc2 UTSW 1 153141594 missense probably benign 0.04
R5811:Lamc2 UTSW 1 153166253 missense possibly damaging 0.53
R6058:Lamc2 UTSW 1 153136829 missense probably benign 0.01
R6130:Lamc2 UTSW 1 153136777 missense probably benign 0.01
R6137:Lamc2 UTSW 1 153166153 missense possibly damaging 0.90
R6994:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6995:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6997:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R7000:Lamc2 UTSW 1 153166127 missense possibly damaging 0.72
R7018:Lamc2 UTSW 1 153136742 missense probably benign 0.00
R7145:Lamc2 UTSW 1 153130772 missense possibly damaging 0.95
R7148:Lamc2 UTSW 1 153185984 missense probably benign 0.01
R7171:Lamc2 UTSW 1 153139749 missense probably damaging 1.00
R7640:Lamc2 UTSW 1 153136804 missense possibly damaging 0.79
R7673:Lamc2 UTSW 1 153124036 missense probably damaging 1.00
R7684:Lamc2 UTSW 1 153127025 missense probably null 0.86
R7712:Lamc2 UTSW 1 153133611 missense possibly damaging 0.81
RF024:Lamc2 UTSW 1 153152055 missense possibly damaging 0.70
Z1176:Lamc2 UTSW 1 153133621 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCCCTTGGTAATAGCAATGGTGGAGTA -3'
(R):5'- CATCCTTGAGTGCGTCTGGAGC -3'

Sequencing Primer
(F):5'- cacagtaggcaacaccattc -3'
(R):5'- GCTCCCATAAGCAGATGGTC -3'
Posted On2014-04-24