Incidental Mutation 'R1631:Olfr516'
ID172794
Institutional Source Beutler Lab
Gene Symbol Olfr516
Ensembl Gene ENSMUSG00000062434
Gene Nameolfactory receptor 516
SynonymsGA_x6K02T2PBJ9-11176324-11175380, MOR268-2
MMRRC Submission 039668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R1631 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108844788-108850529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108845857 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 51 (L51R)
Ref Sequence ENSEMBL: ENSMUSP00000150359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071410] [ENSMUST00000216092] [ENSMUST00000217279]
Predicted Effect probably damaging
Transcript: ENSMUST00000071410
AA Change: L51R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071358
Gene: ENSMUSG00000062434
AA Change: L51R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.9e-5 PFAM
Pfam:7tm_1 41 290 9.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208389
Predicted Effect probably damaging
Transcript: ENSMUST00000216092
AA Change: L51R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217279
AA Change: L51R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik C A 13: 105,082,241 Q28K probably benign Het
Adamts10 T A 17: 33,537,342 S320T probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Als2 T C 1: 59,218,067 E12G probably benign Het
Arhgef10 A T 8: 14,947,157 D321V probably damaging Het
Atp8a1 T G 5: 67,749,052 probably null Het
Avil A G 10: 127,010,625 probably null Het
C2cd3 G A 7: 100,372,497 probably null Het
Col18a1 G A 10: 77,059,297 P1177S probably damaging Het
Copb2 T A 9: 98,580,160 F428L probably benign Het
Cpa1 A G 6: 30,640,924 E138G probably damaging Het
Ctsm T C 13: 61,538,435 I12V possibly damaging Het
Dctn1 A G 6: 83,197,596 Q967R possibly damaging Het
Dok2 T C 14: 70,776,953 Y194H probably damaging Het
Ezh2 C T 6: 47,577,658 M1I probably null Het
Fkbp8 T A 8: 70,531,632 L210Q probably damaging Het
Fpr1 T A 17: 17,877,001 Q242L probably benign Het
Gal3st2b T A 1: 93,940,783 D243E probably damaging Het
Gm281 C T 14: 13,829,796 E649K probably damaging Het
Gm5422 A G 10: 31,249,806 noncoding transcript Het
Gucy1a2 A G 9: 3,533,052 N84D probably damaging Het
Hsd3b5 A C 3: 98,622,077 V79G probably damaging Het
Htr6 A T 4: 139,061,493 V417E probably benign Het
Ifnar2 G A 16: 91,391,867 V79I probably benign Het
Ighv10-1 T C 12: 114,479,482 probably benign Het
Itpr2 A G 6: 146,180,290 F182L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama3 A G 18: 12,407,494 Y285C probably damaging Het
Lamc2 C A 1: 153,158,934 V108L possibly damaging Het
Lrrc14b A G 13: 74,361,254 probably null Het
Magi3 T C 3: 104,051,177 T531A probably benign Het
Mapre2 A G 18: 23,832,954 Y32C probably damaging Het
Med1 C T 11: 98,155,626 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Olfr1351 A T 10: 79,017,405 I28L probably benign Het
Olfr191 G A 16: 59,086,045 T146I probably benign Het
Olfr555 A G 7: 102,659,201 I127V probably damaging Het
Pde1b A G 15: 103,521,672 T143A probably damaging Het
Pkhd1 T C 1: 20,522,897 D1664G probably benign Het
Plod3 C T 5: 136,988,993 R208W probably damaging Het
Pstk G A 7: 131,384,542 A277T possibly damaging Het
Qrich1 T C 9: 108,534,485 V403A probably damaging Het
Rad21 C A 15: 51,970,040 V348F probably damaging Het
Sacs T A 14: 61,210,732 L3409* probably null Het
Setd4 T A 16: 93,593,248 K98* probably null Het
Skint5 A G 4: 113,483,926 V1385A probably benign Het
Stam C A 2: 14,146,248 S472* probably null Het
Stx2 A G 5: 128,992,225 F141L probably damaging Het
Tia1 A G 6: 86,420,348 D101G probably damaging Het
Ttc21a T A 9: 119,954,162 probably null Het
Usp34 T A 11: 23,460,651 N2700K probably damaging Het
Other mutations in Olfr516
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Olfr516 APN 7 108845680 missense probably damaging 0.99
R0583:Olfr516 UTSW 7 108845414 missense possibly damaging 0.87
R0939:Olfr516 UTSW 7 108845233 missense probably damaging 1.00
R1037:Olfr516 UTSW 7 108845984 missense probably benign 0.04
R1691:Olfr516 UTSW 7 108845141 missense possibly damaging 0.60
R5153:Olfr516 UTSW 7 108845699 missense probably benign 0.03
R6114:Olfr516 UTSW 7 108845386 missense possibly damaging 0.53
R6305:Olfr516 UTSW 7 108845554 missense possibly damaging 0.87
R6808:Olfr516 UTSW 7 108845540 missense probably benign 0.01
R6896:Olfr516 UTSW 7 108845543 missense probably benign
R7544:Olfr516 UTSW 7 108845321 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GCAAATCGATCATAAGCCATTGCCC -3'
(R):5'- TGAACTCAGCTCCTGCTCTGTGAC -3'

Sequencing Primer
(F):5'- TAAGCCATTGCCCCCAGG -3'
(R):5'- TGTACTGTGTCCCTAAGACCAAC -3'
Posted On2014-04-24