Incidental Mutation 'R1631:Gucy1a2'
ID172799
Institutional Source Beutler Lab
Gene Symbol Gucy1a2
Ensembl Gene ENSMUSG00000041624
Gene Nameguanylate cyclase 1, soluble, alpha 2
Synonyms6330407I18Rik, A230060L24Rik
MMRRC Submission 039668-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R1631 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location3532778-3894736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3533052 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 84 (N84D)
Ref Sequence ENSEMBL: ENSMUSP00000111398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115733]
Predicted Effect probably damaging
Transcript: ENSMUST00000115733
AA Change: N84D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111398
Gene: ENSMUSG00000041624
AA Change: N84D

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 51 72 N/A INTRINSIC
Pfam:HNOB 121 268 3e-19 PFAM
PDB:4GJ4|D 316 441 1e-17 PDB
CYCc 483 674 6.58e-93 SMART
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213060
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display normal blood vessel and platelet physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik C A 13: 105,082,241 Q28K probably benign Het
Adamts10 T A 17: 33,537,342 S320T probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Als2 T C 1: 59,218,067 E12G probably benign Het
Arhgef10 A T 8: 14,947,157 D321V probably damaging Het
Atp8a1 T G 5: 67,749,052 probably null Het
Avil A G 10: 127,010,625 probably null Het
C2cd3 G A 7: 100,372,497 probably null Het
Col18a1 G A 10: 77,059,297 P1177S probably damaging Het
Copb2 T A 9: 98,580,160 F428L probably benign Het
Cpa1 A G 6: 30,640,924 E138G probably damaging Het
Ctsm T C 13: 61,538,435 I12V possibly damaging Het
Dctn1 A G 6: 83,197,596 Q967R possibly damaging Het
Dok2 T C 14: 70,776,953 Y194H probably damaging Het
Ezh2 C T 6: 47,577,658 M1I probably null Het
Fkbp8 T A 8: 70,531,632 L210Q probably damaging Het
Fpr1 T A 17: 17,877,001 Q242L probably benign Het
Gal3st2b T A 1: 93,940,783 D243E probably damaging Het
Gm281 C T 14: 13,829,796 E649K probably damaging Het
Gm5422 A G 10: 31,249,806 noncoding transcript Het
Hsd3b5 A C 3: 98,622,077 V79G probably damaging Het
Htr6 A T 4: 139,061,493 V417E probably benign Het
Ifnar2 G A 16: 91,391,867 V79I probably benign Het
Ighv10-1 T C 12: 114,479,482 probably benign Het
Itpr2 A G 6: 146,180,290 F182L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama3 A G 18: 12,407,494 Y285C probably damaging Het
Lamc2 C A 1: 153,158,934 V108L possibly damaging Het
Lrrc14b A G 13: 74,361,254 probably null Het
Magi3 T C 3: 104,051,177 T531A probably benign Het
Mapre2 A G 18: 23,832,954 Y32C probably damaging Het
Med1 C T 11: 98,155,626 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Olfr1351 A T 10: 79,017,405 I28L probably benign Het
Olfr191 G A 16: 59,086,045 T146I probably benign Het
Olfr516 A C 7: 108,845,857 L51R probably damaging Het
Olfr555 A G 7: 102,659,201 I127V probably damaging Het
Pde1b A G 15: 103,521,672 T143A probably damaging Het
Pkhd1 T C 1: 20,522,897 D1664G probably benign Het
Plod3 C T 5: 136,988,993 R208W probably damaging Het
Pstk G A 7: 131,384,542 A277T possibly damaging Het
Qrich1 T C 9: 108,534,485 V403A probably damaging Het
Rad21 C A 15: 51,970,040 V348F probably damaging Het
Sacs T A 14: 61,210,732 L3409* probably null Het
Setd4 T A 16: 93,593,248 K98* probably null Het
Skint5 A G 4: 113,483,926 V1385A probably benign Het
Stam C A 2: 14,146,248 S472* probably null Het
Stx2 A G 5: 128,992,225 F141L probably damaging Het
Tia1 A G 6: 86,420,348 D101G probably damaging Het
Ttc21a T A 9: 119,954,162 probably null Het
Usp34 T A 11: 23,460,651 N2700K probably damaging Het
Other mutations in Gucy1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Gucy1a2 APN 9 3759418 missense probably damaging 1.00
IGL00768:Gucy1a2 APN 9 3635111 missense possibly damaging 0.65
IGL00928:Gucy1a2 APN 9 3759777 missense probably damaging 1.00
IGL01520:Gucy1a2 APN 9 3759561 missense probably damaging 0.99
IGL01566:Gucy1a2 APN 9 3634661 missense probably damaging 1.00
IGL01819:Gucy1a2 APN 9 3865409 nonsense probably null
IGL01874:Gucy1a2 APN 9 3797343 missense probably damaging 1.00
IGL02442:Gucy1a2 APN 9 3865385 missense probably damaging 1.00
IGL02608:Gucy1a2 APN 9 3635113 missense probably damaging 0.99
IGL02612:Gucy1a2 APN 9 3894556 missense possibly damaging 0.74
IGL02719:Gucy1a2 APN 9 3894719 utr 3 prime probably benign
IGL02823:Gucy1a2 APN 9 3894656 missense possibly damaging 0.79
IGL02852:Gucy1a2 APN 9 3759691 missense probably benign 0.31
IGL02892:Gucy1a2 APN 9 3634471 missense probably damaging 1.00
IGL02964:Gucy1a2 APN 9 3759542 missense probably damaging 0.96
Rico UTSW 9 3579513 splice site probably null
R0096:Gucy1a2 UTSW 9 3758928 intron probably benign
R0417:Gucy1a2 UTSW 9 3759484 missense possibly damaging 0.80
R0920:Gucy1a2 UTSW 9 3759472 missense probably damaging 1.00
R1146:Gucy1a2 UTSW 9 3759830 missense probably damaging 1.00
R1146:Gucy1a2 UTSW 9 3759830 missense probably damaging 1.00
R1384:Gucy1a2 UTSW 9 3759620 missense probably damaging 1.00
R1711:Gucy1a2 UTSW 9 3759622 missense probably benign 0.04
R1730:Gucy1a2 UTSW 9 3634957 missense probably benign 0.36
R1800:Gucy1a2 UTSW 9 3582685 missense possibly damaging 0.62
R2069:Gucy1a2 UTSW 9 3582697 missense probably damaging 1.00
R2166:Gucy1a2 UTSW 9 3579513 splice site probably null
R2357:Gucy1a2 UTSW 9 3797299 missense probably damaging 0.97
R3401:Gucy1a2 UTSW 9 3635154 missense probably benign 0.00
R3953:Gucy1a2 UTSW 9 3582704 splice site probably benign
R4420:Gucy1a2 UTSW 9 3634640 missense probably damaging 1.00
R4731:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4732:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4733:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4931:Gucy1a2 UTSW 9 3759588 missense probably damaging 1.00
R5094:Gucy1a2 UTSW 9 3865443 missense probably damaging 1.00
R5852:Gucy1a2 UTSW 9 3865460 missense probably damaging 0.99
R6005:Gucy1a2 UTSW 9 3865518 splice site probably null
R7667:Gucy1a2 UTSW 9 3759580 missense probably damaging 1.00
R7841:Gucy1a2 UTSW 9 3634766 missense probably benign 0.03
R7866:Gucy1a2 UTSW 9 3532804 start codon destroyed probably null
R8525:Gucy1a2 UTSW 9 3865365 missense probably damaging 1.00
R8802:Gucy1a2 UTSW 9 3635050 missense probably benign 0.03
Z1176:Gucy1a2 UTSW 9 3635156 missense probably damaging 1.00
Z1177:Gucy1a2 UTSW 9 3797245 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCCAGCAGCATGTCTCGAAGAAAG -3'
(R):5'- TTAGGGACCACGAAGAACTCAGGACC -3'

Sequencing Primer
(F):5'- AGCTCTGACTACCTGGAGAC -3'
(R):5'- CTCAGGACCAAAGAGGGTG -3'
Posted On2014-04-24