Incidental Mutation 'R1631:Rad21'
ID172816
Institutional Source Beutler Lab
Gene Symbol Rad21
Ensembl Gene ENSMUSG00000022314
Gene NameRAD21 cohesin complex component
SynonymsSCC1
MMRRC Submission 039668-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1631 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location51962240-51991747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 51970040 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 348 (V348F)
Ref Sequence ENSEMBL: ENSMUSP00000022927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022927] [ENSMUST00000226529]
Predicted Effect probably damaging
Transcript: ENSMUST00000022927
AA Change: V348F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022927
Gene: ENSMUSG00000022314
AA Change: V348F

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 107 6.6e-43 PFAM
low complexity region 267 283 N/A INTRINSIC
low complexity region 430 440 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
low complexity region 521 547 N/A INTRINSIC
Pfam:Rad21_Rec8 578 632 2.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226529
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad21, a gene involved in the repair of DNA double-strand breaks, as well as in chromatid cohesion during mitosis. This protein is a nuclear phospho-protein, which becomes hyperphosphorylated in cell cycle M phase. The highly regulated association of this protein with mitotic chromatin specifically at the centromere region suggests its role in sister chromatid cohesion in mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality, reduced male fertility, and produce oocytes that fail to maintain sister chromatids in the first mitosis following fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik C A 13: 105,082,241 Q28K probably benign Het
Adamts10 T A 17: 33,537,342 S320T probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Als2 T C 1: 59,218,067 E12G probably benign Het
Arhgef10 A T 8: 14,947,157 D321V probably damaging Het
Atp8a1 T G 5: 67,749,052 probably null Het
Avil A G 10: 127,010,625 probably null Het
C2cd3 G A 7: 100,372,497 probably null Het
Col18a1 G A 10: 77,059,297 P1177S probably damaging Het
Copb2 T A 9: 98,580,160 F428L probably benign Het
Cpa1 A G 6: 30,640,924 E138G probably damaging Het
Ctsm T C 13: 61,538,435 I12V possibly damaging Het
Dctn1 A G 6: 83,197,596 Q967R possibly damaging Het
Dok2 T C 14: 70,776,953 Y194H probably damaging Het
Ezh2 C T 6: 47,577,658 M1I probably null Het
Fkbp8 T A 8: 70,531,632 L210Q probably damaging Het
Fpr1 T A 17: 17,877,001 Q242L probably benign Het
Gal3st2b T A 1: 93,940,783 D243E probably damaging Het
Gm281 C T 14: 13,829,796 E649K probably damaging Het
Gm5422 A G 10: 31,249,806 noncoding transcript Het
Gucy1a2 A G 9: 3,533,052 N84D probably damaging Het
Hsd3b5 A C 3: 98,622,077 V79G probably damaging Het
Htr6 A T 4: 139,061,493 V417E probably benign Het
Ifnar2 G A 16: 91,391,867 V79I probably benign Het
Ighv10-1 T C 12: 114,479,482 probably benign Het
Itpr2 A G 6: 146,180,290 F182L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama3 A G 18: 12,407,494 Y285C probably damaging Het
Lamc2 C A 1: 153,158,934 V108L possibly damaging Het
Lrrc14b A G 13: 74,361,254 probably null Het
Magi3 T C 3: 104,051,177 T531A probably benign Het
Mapre2 A G 18: 23,832,954 Y32C probably damaging Het
Med1 C T 11: 98,155,626 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Olfr1351 A T 10: 79,017,405 I28L probably benign Het
Olfr191 G A 16: 59,086,045 T146I probably benign Het
Olfr516 A C 7: 108,845,857 L51R probably damaging Het
Olfr555 A G 7: 102,659,201 I127V probably damaging Het
Pde1b A G 15: 103,521,672 T143A probably damaging Het
Pkhd1 T C 1: 20,522,897 D1664G probably benign Het
Plod3 C T 5: 136,988,993 R208W probably damaging Het
Pstk G A 7: 131,384,542 A277T possibly damaging Het
Qrich1 T C 9: 108,534,485 V403A probably damaging Het
Sacs T A 14: 61,210,732 L3409* probably null Het
Setd4 T A 16: 93,593,248 K98* probably null Het
Skint5 A G 4: 113,483,926 V1385A probably benign Het
Stam C A 2: 14,146,248 S472* probably null Het
Stx2 A G 5: 128,992,225 F141L probably damaging Het
Tia1 A G 6: 86,420,348 D101G probably damaging Het
Ttc21a T A 9: 119,954,162 probably null Het
Usp34 T A 11: 23,460,651 N2700K probably damaging Het
Other mutations in Rad21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Rad21 APN 15 51976125 missense possibly damaging 0.76
IGL01328:Rad21 APN 15 51973124 missense probably damaging 1.00
PIT4449001:Rad21 UTSW 15 51973243 missense probably benign 0.25
R0119:Rad21 UTSW 15 51965030 missense probably benign 0.01
R0299:Rad21 UTSW 15 51965030 missense probably benign 0.01
R0385:Rad21 UTSW 15 51973863 missense possibly damaging 0.70
R0440:Rad21 UTSW 15 51968358 missense probably benign 0.24
R1216:Rad21 UTSW 15 51970136 missense possibly damaging 0.70
R1763:Rad21 UTSW 15 51978170 missense probably damaging 1.00
R1769:Rad21 UTSW 15 51972307 missense probably benign
R2377:Rad21 UTSW 15 51968438 missense probably damaging 0.99
R2761:Rad21 UTSW 15 51982643 missense probably damaging 1.00
R3116:Rad21 UTSW 15 51965001 missense probably null 1.00
R3853:Rad21 UTSW 15 51972316 missense probably benign
R3875:Rad21 UTSW 15 51969965 missense probably damaging 0.99
R4618:Rad21 UTSW 15 51970024 missense probably damaging 1.00
R4856:Rad21 UTSW 15 51968500 missense probably damaging 1.00
R4886:Rad21 UTSW 15 51968500 missense probably damaging 1.00
R5022:Rad21 UTSW 15 51966706 missense probably benign 0.02
R5057:Rad21 UTSW 15 51966706 missense probably benign 0.02
R7288:Rad21 UTSW 15 51982580 missense possibly damaging 0.94
R7840:Rad21 UTSW 15 51973142 missense probably damaging 1.00
R7923:Rad21 UTSW 15 51973142 missense probably damaging 1.00
R8033:Rad21 UTSW 15 51964232 missense probably damaging 1.00
Z1088:Rad21 UTSW 15 51982626 missense probably damaging 0.97
Z1177:Rad21 UTSW 15 51978058 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCCCATCAGTACGTGAGCCAAG -3'
(R):5'- TGCCTAGCTCTGTGTCTAGAAAGTCAG -3'

Sequencing Primer
(F):5'- GCACGTATCAGTTTGAGCAC -3'
(R):5'- CTGTGTCTAGAAAGTCAGAGGATAAC -3'
Posted On2014-04-24