Incidental Mutation 'R1632:Nphp1'
ID172831
Institutional Source Beutler Lab
Gene Symbol Nphp1
Ensembl Gene ENSMUSG00000027378
Gene Namenephronophthisis 1 (juvenile) homolog (human)
Synonymsnephrocystin
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1632 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127740732-127788897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 127770392 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 212 (P212T)
Ref Sequence ENSEMBL: ENSMUSP00000105986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028857] [ENSMUST00000110357]
Predicted Effect probably benign
Transcript: ENSMUST00000028857
AA Change: P212T

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028857
Gene: ENSMUSG00000027378
AA Change: P212T

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 391 491 3e-55 BLAST
low complexity region 634 641 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110357
AA Change: P212T

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105986
Gene: ENSMUSG00000027378
AA Change: P212T

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 390 490 3e-55 BLAST
low complexity region 633 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to defects in sperm maturation. Mice homozygous for another knock-out allele exhibit absent photoreceptor outer segment and photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Cyp2j8 T A 4: 96,447,324 H411L probably benign Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dhrs3 T C 4: 144,893,546 V11A probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
Gtpbp2 A G 17: 46,168,592 R590G probably benign Het
H2-M3 G A 17: 37,271,163 R170H probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Il6st G T 13: 112,504,332 D820Y possibly damaging Het
Kdm7a A G 6: 39,152,898 V448A probably benign Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Kri1 T C 9: 21,282,211 D140G possibly damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mpp5 T A 12: 78,797,038 Y5* probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Phf19 G A 2: 34,911,619 R60W probably damaging Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tas2r118 A G 6: 23,969,261 I267T probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Zfp329 T C 7: 12,810,949 D216G possibly damaging Het
Other mutations in Nphp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nphp1 APN 2 127763885 missense probably damaging 0.99
IGL00589:Nphp1 APN 2 127763849 missense probably damaging 1.00
IGL01143:Nphp1 APN 2 127780136 missense probably benign 0.06
IGL01893:Nphp1 APN 2 127769644 missense probably damaging 1.00
IGL01922:Nphp1 APN 2 127780069 missense possibly damaging 0.95
IGL02123:Nphp1 APN 2 127754049 missense probably benign 0.03
IGL02340:Nphp1 APN 2 127780067 nonsense probably null
IGL02836:Nphp1 APN 2 127769623 missense probably benign 0.00
IGL03109:Nphp1 APN 2 127768169 critical splice donor site probably benign
R1857:Nphp1 UTSW 2 127770376 missense probably benign 0.00
R4425:Nphp1 UTSW 2 127788799 missense possibly damaging 0.82
R4514:Nphp1 UTSW 2 127748087 missense probably benign 0.26
R4546:Nphp1 UTSW 2 127766019 splice site probably null
R4580:Nphp1 UTSW 2 127768169 critical splice donor site probably null
R5634:Nphp1 UTSW 2 127759650 missense possibly damaging 0.81
R7152:Nphp1 UTSW 2 127753979 missense probably benign
R7326:Nphp1 UTSW 2 127761217 missense possibly damaging 0.76
R8029:Nphp1 UTSW 2 127741116 missense probably benign 0.00
X0022:Nphp1 UTSW 2 127761214 missense probably damaging 1.00
X0025:Nphp1 UTSW 2 127779127 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCACATACAACCCACTAAACACATGCT -3'
(R):5'- GCTAAACTTATCTCTCCtcctcttcttcttct -3'

Sequencing Primer
(F):5'- TAAACACATGCTCGAACATGC -3'
(R):5'- CAGATACCCTCACCTATGCTAAGTAC -3'
Posted On2014-04-24