Incidental Mutation 'R1632:Cyp2j8'
ID172834
Institutional Source Beutler Lab
Gene Symbol Cyp2j8
Ensembl Gene ENSMUSG00000082932
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 8
SynonymsCyp2j8-ps, OTTMUSG00000007938
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1632 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location96444596-96507386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96447324 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 411 (H411L)
Ref Sequence ENSEMBL: ENSMUSP00000134591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124729]
Predicted Effect probably benign
Transcript: ENSMUST00000124729
AA Change: H411L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134591
Gene: ENSMUSG00000082932
AA Change: H411L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 500 1.2e-134 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dhrs3 T C 4: 144,893,546 V11A probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
Gtpbp2 A G 17: 46,168,592 R590G probably benign Het
H2-M3 G A 17: 37,271,163 R170H probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Il6st G T 13: 112,504,332 D820Y possibly damaging Het
Kdm7a A G 6: 39,152,898 V448A probably benign Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Kri1 T C 9: 21,282,211 D140G possibly damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mpp5 T A 12: 78,797,038 Y5* probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Nphp1 G T 2: 127,770,392 P212T probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Phf19 G A 2: 34,911,619 R60W probably damaging Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tas2r118 A G 6: 23,969,261 I267T probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Zfp329 T C 7: 12,810,949 D216G possibly damaging Het
Other mutations in Cyp2j8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Cyp2j8 APN 4 96503842 missense probably benign 0.06
IGL00418:Cyp2j8 APN 4 96444616 missense possibly damaging 0.85
IGL01577:Cyp2j8 APN 4 96479071 missense probably damaging 0.96
IGL01629:Cyp2j8 APN 4 96499603 missense probably damaging 1.00
IGL01928:Cyp2j8 APN 4 96470476 splice site probably benign
IGL01978:Cyp2j8 APN 4 96504009 splice site probably null
IGL02053:Cyp2j8 APN 4 96470654 missense probably damaging 1.00
IGL02500:Cyp2j8 APN 4 96470650 missense probably damaging 1.00
IGL02947:Cyp2j8 APN 4 96470578 missense probably damaging 1.00
cyprus UTSW 4 96499603 missense probably damaging 1.00
R0558:Cyp2j8 UTSW 4 96444634 missense probably benign 0.01
R0718:Cyp2j8 UTSW 4 96501196 missense probably benign
R1553:Cyp2j8 UTSW 4 96475557 missense probably benign
R1557:Cyp2j8 UTSW 4 96470476 splice site probably benign
R1708:Cyp2j8 UTSW 4 96499595 missense probably damaging 1.00
R2119:Cyp2j8 UTSW 4 96507201 missense probably benign
R2220:Cyp2j8 UTSW 4 96444625 missense probably benign 0.03
R3123:Cyp2j8 UTSW 4 96501213 splice site probably benign
R3735:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R3736:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R4326:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4327:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4762:Cyp2j8 UTSW 4 96470649 missense probably damaging 1.00
R4901:Cyp2j8 UTSW 4 96479086 missense probably benign 0.16
R4960:Cyp2j8 UTSW 4 96507377 missense probably benign
R5260:Cyp2j8 UTSW 4 96501064 missense possibly damaging 0.65
R5562:Cyp2j8 UTSW 4 96470653 missense probably damaging 1.00
R5596:Cyp2j8 UTSW 4 96507341 missense probably benign 0.00
R5741:Cyp2j8 UTSW 4 96444643 missense probably benign 0.00
R5825:Cyp2j8 UTSW 4 96507214 missense probably benign 0.01
R5903:Cyp2j8 UTSW 4 96507277 missense possibly damaging 0.46
R6122:Cyp2j8 UTSW 4 96444640 missense probably benign
R6232:Cyp2j8 UTSW 4 96507190 missense possibly damaging 0.94
R6748:Cyp2j8 UTSW 4 96475545 missense probably benign 0.01
R6931:Cyp2j8 UTSW 4 96444781 splice site probably null
R7000:Cyp2j8 UTSW 4 96447351 missense probably benign 0.06
R7183:Cyp2j8 UTSW 4 96479181 missense probably damaging 0.97
R7186:Cyp2j8 UTSW 4 96475550 missense probably benign 0.00
R7348:Cyp2j8 UTSW 4 96444640 missense probably benign 0.00
R7575:Cyp2j8 UTSW 4 96470548 missense possibly damaging 0.63
R7648:Cyp2j8 UTSW 4 96499603 missense probably damaging 1.00
R7975:Cyp2j8 UTSW 4 96470539 missense possibly damaging 0.65
R7993:Cyp2j8 UTSW 4 96447219 critical splice donor site probably null
R8878:Cyp2j8 UTSW 4 96470570 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ACCAGATGTTGGTTGCACTGGGAG -3'
(R):5'- TGTGGGGTAAAGGAACACTTTGGC -3'

Sequencing Primer
(F):5'- CTAATTACAGCAGAAATCTTGAGGG -3'
(R):5'- GGACTGGCTTCACAGGCTATATAC -3'
Posted On2014-04-24