Incidental Mutation 'R1632:Tas2r118'
ID172843
Institutional Source Beutler Lab
Gene Symbol Tas2r118
Ensembl Gene ENSMUSG00000043865
Gene Nametaste receptor, type 2, member 118
SynonymsmGR18, mt2r40, T2R18, Tas2r18
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1632 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location23969161-23970060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23969261 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 267 (I267T)
Ref Sequence ENSEMBL: ENSMUSP00000053700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062463]
Predicted Effect probably benign
Transcript: ENSMUST00000062463
AA Change: I267T

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000053700
Gene: ENSMUSG00000043865
AA Change: I267T

DomainStartEndE-ValueType
Pfam:TAS2R 1 297 4.6e-87 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily. These family members are specifically expressed by taste receptor cells of the tongue and palate epithelia. Each of these apparently intronless genes encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Cyp2j8 T A 4: 96,447,324 H411L probably benign Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dhrs3 T C 4: 144,893,546 V11A probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
Gtpbp2 A G 17: 46,168,592 R590G probably benign Het
H2-M3 G A 17: 37,271,163 R170H probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Il6st G T 13: 112,504,332 D820Y possibly damaging Het
Kdm7a A G 6: 39,152,898 V448A probably benign Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Kri1 T C 9: 21,282,211 D140G possibly damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mpp5 T A 12: 78,797,038 Y5* probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Nphp1 G T 2: 127,770,392 P212T probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Phf19 G A 2: 34,911,619 R60W probably damaging Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Zfp329 T C 7: 12,810,949 D216G possibly damaging Het
Other mutations in Tas2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Tas2r118 APN 6 23969747 missense probably damaging 0.99
IGL02517:Tas2r118 APN 6 23969892 missense probably damaging 1.00
IGL03387:Tas2r118 APN 6 23969181 missense possibly damaging 0.71
PIT4382001:Tas2r118 UTSW 6 23969786 missense possibly damaging 0.61
R0241:Tas2r118 UTSW 6 23969339 missense probably damaging 1.00
R0241:Tas2r118 UTSW 6 23969339 missense probably damaging 1.00
R0544:Tas2r118 UTSW 6 23969401 missense probably damaging 0.97
R1438:Tas2r118 UTSW 6 23969423 missense possibly damaging 0.79
R1471:Tas2r118 UTSW 6 23969171 missense probably damaging 0.96
R2096:Tas2r118 UTSW 6 23969913 missense possibly damaging 0.90
R2106:Tas2r118 UTSW 6 23969570 missense probably benign
R2903:Tas2r118 UTSW 6 23969802 missense possibly damaging 0.87
R2904:Tas2r118 UTSW 6 23969802 missense possibly damaging 0.87
R2905:Tas2r118 UTSW 6 23969802 missense possibly damaging 0.87
R3798:Tas2r118 UTSW 6 23969823 missense possibly damaging 0.71
R4402:Tas2r118 UTSW 6 23969294 missense probably benign 0.11
R4647:Tas2r118 UTSW 6 23969468 missense probably damaging 1.00
R4707:Tas2r118 UTSW 6 23969226 missense probably benign 0.26
R4965:Tas2r118 UTSW 6 23969628 missense probably benign 0.41
R5114:Tas2r118 UTSW 6 23969210 missense probably benign 0.05
R5823:Tas2r118 UTSW 6 23969471 missense probably benign 0.04
R5834:Tas2r118 UTSW 6 23969877 missense probably benign 0.06
R6976:Tas2r118 UTSW 6 23969471 missense probably benign 0.04
R7335:Tas2r118 UTSW 6 23969750 missense probably damaging 1.00
X0062:Tas2r118 UTSW 6 23969440 missense probably damaging 1.00
Z1177:Tas2r118 UTSW 6 23969559 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCAATGCAAAGTCTCCTTACCC -3'
(R):5'- TGCTGTCCTCTACTGTGTCAAGGTC -3'

Sequencing Primer
(F):5'- TTACCCTAGAGGCTTAACTGTG -3'
(R):5'- TCCTCTGGCTGAGGATGAAAATC -3'
Posted On2014-04-24