Incidental Mutation 'R1632:Kdm7a'
ID172844
Institutional Source Beutler Lab
Gene Symbol Kdm7a
Ensembl Gene ENSMUSG00000042599
Gene Namelysine (K)-specific demethylase 7A
SynonymsKdm7a, Jhdm1d, ENSMUSG00000073143, A630082K20Rik
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1632 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location39136623-39206789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39152898 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 448 (V448A)
Ref Sequence ENSEMBL: ENSMUSP00000002305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002305]
Predicted Effect probably benign
Transcript: ENSMUST00000002305
AA Change: V448A

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000002305
Gene: ENSMUSG00000042599
AA Change: V448A

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
PHD 39 86 8.64e-9 SMART
low complexity region 186 197 N/A INTRINSIC
JmjC 230 386 1.09e-49 SMART
low complexity region 408 419 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146981
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants exhibit abnormal hair follicle, tail, sebaceous gland, rib, and vertebrae morphology and decreased circulating iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Cyp2j8 T A 4: 96,447,324 H411L probably benign Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dhrs3 T C 4: 144,893,546 V11A probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
Gtpbp2 A G 17: 46,168,592 R590G probably benign Het
H2-M3 G A 17: 37,271,163 R170H probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Il6st G T 13: 112,504,332 D820Y possibly damaging Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Kri1 T C 9: 21,282,211 D140G possibly damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mpp5 T A 12: 78,797,038 Y5* probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Nphp1 G T 2: 127,770,392 P212T probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Phf19 G A 2: 34,911,619 R60W probably damaging Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tas2r118 A G 6: 23,969,261 I267T probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Zfp329 T C 7: 12,810,949 D216G possibly damaging Het
Other mutations in Kdm7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kdm7a APN 6 39144510 missense probably benign
IGL00976:Kdm7a APN 6 39144398 missense possibly damaging 0.90
IGL01063:Kdm7a APN 6 39165130 missense probably damaging 0.98
IGL01325:Kdm7a APN 6 39158309 splice site probably benign
IGL01710:Kdm7a APN 6 39175386 missense probably benign 0.06
IGL01953:Kdm7a APN 6 39146902 missense probably benign 0.10
IGL02336:Kdm7a APN 6 39170264 missense probably damaging 1.00
IGL02721:Kdm7a APN 6 39173437 missense possibly damaging 0.93
IGL02963:Kdm7a APN 6 39143230 missense probably damaging 1.00
IGL03165:Kdm7a APN 6 39170914 splice site probably benign
R0033:Kdm7a UTSW 6 39165197 nonsense probably null
R0831:Kdm7a UTSW 6 39166765 splice site probably benign
R0920:Kdm7a UTSW 6 39151322 missense probably damaging 1.00
R0962:Kdm7a UTSW 6 39147194 missense probably benign 0.05
R1403:Kdm7a UTSW 6 39151253 splice site probably benign
R1759:Kdm7a UTSW 6 39147699 splice site probably null
R2143:Kdm7a UTSW 6 39168950 missense possibly damaging 0.61
R2197:Kdm7a UTSW 6 39146936 missense probably damaging 0.98
R2496:Kdm7a UTSW 6 39170763 splice site probably null
R3844:Kdm7a UTSW 6 39181579 missense probably damaging 1.00
R4083:Kdm7a UTSW 6 39152814 missense probably damaging 1.00
R4184:Kdm7a UTSW 6 39148977 missense probably benign
R4193:Kdm7a UTSW 6 39169096 missense probably damaging 1.00
R4402:Kdm7a UTSW 6 39166668 missense probably null 1.00
R4544:Kdm7a UTSW 6 39175472 missense probably benign 0.08
R4546:Kdm7a UTSW 6 39175472 missense probably benign 0.08
R4560:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4561:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4562:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4563:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4737:Kdm7a UTSW 6 39152839 missense possibly damaging 0.57
R5061:Kdm7a UTSW 6 39151452 missense possibly damaging 0.88
R5247:Kdm7a UTSW 6 39144456 missense probably benign 0.00
R5430:Kdm7a UTSW 6 39149342 missense possibly damaging 0.85
R6248:Kdm7a UTSW 6 39147049 missense possibly damaging 0.63
R6254:Kdm7a UTSW 6 39170269 missense probably damaging 1.00
R6346:Kdm7a UTSW 6 39151211 intron probably null
R6420:Kdm7a UTSW 6 39165168 missense probably damaging 1.00
R6908:Kdm7a UTSW 6 39144439 missense possibly damaging 0.79
R6966:Kdm7a UTSW 6 39152839 missense probably damaging 1.00
R7048:Kdm7a UTSW 6 39169048 missense probably damaging 1.00
R7087:Kdm7a UTSW 6 39175381 missense probably benign 0.18
R7450:Kdm7a UTSW 6 39143251 missense probably damaging 1.00
R7737:Kdm7a UTSW 6 39144404 missense probably benign 0.03
RF012:Kdm7a UTSW 6 39206513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACAGTGGCAGATCTATTGGTTC -3'
(R):5'- TCACAGCAGGATTTGAGGTGTAGAGTA -3'

Sequencing Primer
(F):5'- GGCAGATCTATTGGTTCTCAAGAC -3'
(R):5'- gatctctctgtccctacctcc -3'
Posted On2014-04-24