Incidental Mutation 'R1632:Zfp329'
ID172846
Institutional Source Beutler Lab
Gene Symbol Zfp329
Ensembl Gene ENSMUSG00000057894
Gene Namezinc finger protein 329
Synonyms
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1632 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12804977-12818858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12810949 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 216 (D216G)
Ref Sequence ENSEMBL: ENSMUSP00000104186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072222] [ENSMUST00000108546] [ENSMUST00000121215]
Predicted Effect probably benign
Transcript: ENSMUST00000072222
AA Change: D216G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072079
Gene: ENSMUSG00000057894
AA Change: D216G

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108546
AA Change: D216G

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104186
Gene: ENSMUSG00000057894
AA Change: D216G

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121215
AA Change: D216G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113355
Gene: ENSMUSG00000057894
AA Change: D216G

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129647
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Cyp2j8 T A 4: 96,447,324 H411L probably benign Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dhrs3 T C 4: 144,893,546 V11A probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
Gtpbp2 A G 17: 46,168,592 R590G probably benign Het
H2-M3 G A 17: 37,271,163 R170H probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Il6st G T 13: 112,504,332 D820Y possibly damaging Het
Kdm7a A G 6: 39,152,898 V448A probably benign Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Kri1 T C 9: 21,282,211 D140G possibly damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mpp5 T A 12: 78,797,038 Y5* probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Nphp1 G T 2: 127,770,392 P212T probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Phf19 G A 2: 34,911,619 R60W probably damaging Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tas2r118 A G 6: 23,969,261 I267T probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Other mutations in Zfp329
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Zfp329 APN 7 12811179 missense possibly damaging 0.87
IGL02830:Zfp329 APN 7 12810116 missense probably damaging 1.00
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0122:Zfp329 UTSW 7 12810987 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0539:Zfp329 UTSW 7 12806593 critical splice acceptor site probably null
R0570:Zfp329 UTSW 7 12810452 missense probably damaging 1.00
R0682:Zfp329 UTSW 7 12810284 missense probably damaging 1.00
R0811:Zfp329 UTSW 7 12811468 missense probably benign
R0812:Zfp329 UTSW 7 12811468 missense probably benign
R0944:Zfp329 UTSW 7 12811468 missense probably benign
R0945:Zfp329 UTSW 7 12811468 missense probably benign
R0946:Zfp329 UTSW 7 12811468 missense probably benign
R0948:Zfp329 UTSW 7 12811468 missense probably benign
R1980:Zfp329 UTSW 7 12811468 missense probably benign
R2172:Zfp329 UTSW 7 12810767 missense probably damaging 1.00
R2897:Zfp329 UTSW 7 12810486 missense probably damaging 1.00
R4256:Zfp329 UTSW 7 12807913 missense probably benign 0.03
R4383:Zfp329 UTSW 7 12811657 start gained probably benign
R4384:Zfp329 UTSW 7 12811657 start gained probably benign
R4692:Zfp329 UTSW 7 12810632 missense probably damaging 1.00
R5260:Zfp329 UTSW 7 12806526 unclassified probably benign
R5327:Zfp329 UTSW 7 12811494 missense probably benign 0.04
R5679:Zfp329 UTSW 7 12810031 missense probably damaging 0.96
R6886:Zfp329 UTSW 7 12810098 missense probably benign 0.00
R6904:Zfp329 UTSW 7 12806530 unclassified probably benign
R7304:Zfp329 UTSW 7 12810899 missense probably damaging 1.00
R7564:Zfp329 UTSW 7 12811040 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGACTGAAGGATTTCCCACAC -3'
(R):5'- TTTGGGGACATCTTAGCCCTGAGC -3'

Sequencing Primer
(F):5'- gcctttccacatctgctacac -3'
(R):5'- AATGTGCCGAATGTGGCA -3'
Posted On2014-04-24