Incidental Mutation 'R1632:Kri1'
ID172856
Institutional Source Beutler Lab
Gene Symbol Kri1
Ensembl Gene ENSMUSG00000035047
Gene NameKRI1 homolog
Synonyms
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1632 (G1)
Quality Score219
Status Not validated
Chromosome9
Chromosomal Location21273457-21287969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21282211 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 140 (D140G)
Ref Sequence ENSEMBL: ENSMUSP00000039688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038671] [ENSMUST00000065005] [ENSMUST00000184326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038671
AA Change: D140G

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039688
Gene: ENSMUSG00000035047
AA Change: D140G

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
Pfam:Kri1 346 439 3.2e-27 PFAM
Pfam:Kri1_C 507 595 8.4e-37 PFAM
low complexity region 653 666 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065005
SMART Domains Protein: ENSMUSP00000068450
Gene: ENSMUSG00000002820

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
Pfam:Peptidase_C54 109 411 5.7e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183912
Predicted Effect probably benign
Transcript: ENSMUST00000184326
AA Change: D22G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139184
Gene: ENSMUSG00000035047
AA Change: D22G

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
Pfam:Kri1 207 317 4.4e-27 PFAM
Pfam:Kri1_C 381 472 3.6e-36 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192279
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene overlaps with the gene for cysteine endopeptidase AUT-like 4 in a head-to-tail orientation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Cyp2j8 T A 4: 96,447,324 H411L probably benign Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dhrs3 T C 4: 144,893,546 V11A probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
Gtpbp2 A G 17: 46,168,592 R590G probably benign Het
H2-M3 G A 17: 37,271,163 R170H probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Il6st G T 13: 112,504,332 D820Y possibly damaging Het
Kdm7a A G 6: 39,152,898 V448A probably benign Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mpp5 T A 12: 78,797,038 Y5* probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Nphp1 G T 2: 127,770,392 P212T probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Phf19 G A 2: 34,911,619 R60W probably damaging Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tas2r118 A G 6: 23,969,261 I267T probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Zfp329 T C 7: 12,810,949 D216G possibly damaging Het
Other mutations in Kri1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Kri1 APN 9 21280427 missense probably damaging 1.00
IGL02272:Kri1 APN 9 21276168 missense probably damaging 1.00
IGL03229:Kri1 APN 9 21282070 missense probably damaging 1.00
FR4548:Kri1 UTSW 9 21281050 small deletion probably benign
R0040:Kri1 UTSW 9 21281105 missense probably damaging 1.00
R0054:Kri1 UTSW 9 21275365 missense probably damaging 1.00
R0054:Kri1 UTSW 9 21275365 missense probably damaging 1.00
R0284:Kri1 UTSW 9 21276552 splice site probably benign
R0665:Kri1 UTSW 9 21281640 intron probably benign
R1640:Kri1 UTSW 9 21280457 missense possibly damaging 0.61
R1847:Kri1 UTSW 9 21280492 splice site probably benign
R3154:Kri1 UTSW 9 21281894 missense possibly damaging 0.51
R4222:Kri1 UTSW 9 21281063 missense probably benign 0.00
R4572:Kri1 UTSW 9 21280384 missense probably damaging 1.00
R4905:Kri1 UTSW 9 21287702 missense probably benign 0.19
R5236:Kri1 UTSW 9 21275941 missense probably damaging 1.00
R5539:Kri1 UTSW 9 21279372 nonsense probably null
R5696:Kri1 UTSW 9 21280237 missense probably damaging 1.00
R5701:Kri1 UTSW 9 21281129 missense possibly damaging 0.89
R6031:Kri1 UTSW 9 21275269 missense probably benign 0.03
R6031:Kri1 UTSW 9 21275269 missense probably benign 0.03
R6991:Kri1 UTSW 9 21287754 unclassified probably benign
R6994:Kri1 UTSW 9 21287787 unclassified probably benign
R7095:Kri1 UTSW 9 21279432 missense
R7339:Kri1 UTSW 9 21286587 missense
R7652:Kri1 UTSW 9 21281056 small deletion probably benign
R7787:Kri1 UTSW 9 21281084 missense
R7908:Kri1 UTSW 9 21281056 small deletion probably benign
RF027:Kri1 UTSW 9 21281068 frame shift probably null
RF028:Kri1 UTSW 9 21281071 frame shift probably null
RF058:Kri1 UTSW 9 21281066 frame shift probably null
Z1088:Kri1 UTSW 9 21274122 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATCACTGCTGTCCTCCACAAAAG -3'
(R):5'- GCCATATTCATGCGATACACGCAC -3'

Sequencing Primer
(F):5'- GTGCGTTACTAGCCCTGAG -3'
(R):5'- TGCGATACACGCACACATTAC -3'
Posted On2014-04-24