Incidental Mutation 'R1632:Il6st'
ID172869
Institutional Source Beutler Lab
Gene Symbol Il6st
Ensembl Gene ENSMUSG00000021756
Gene Nameinterleukin 6 signal transducer
SynonymsD13Ertd699e, gp130, CD130, 5133400A03Rik
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1632 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112464070-112510086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 112504332 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 820 (D820Y)
Ref Sequence ENSEMBL: ENSMUSP00000138915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070731] [ENSMUST00000183513] [ENSMUST00000183663] [ENSMUST00000183829] [ENSMUST00000184276] [ENSMUST00000184311] [ENSMUST00000184445] [ENSMUST00000184949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070731
AA Change: D881Y

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064205
Gene: ENSMUSG00000021756
AA Change: D881Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 26 112 1.4e-30 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183513
SMART Domains Protein: ENSMUSP00000139016
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183663
AA Change: D881Y

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138836
Gene: ENSMUSG00000021756
AA Change: D881Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183829
SMART Domains Protein: ENSMUSP00000138987
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:1I1R|A 23 52 7e-8 PDB
FN3 56 142 7.23e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184276
SMART Domains Protein: ENSMUSP00000139060
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2.3e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184311
AA Change: D881Y

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139227
Gene: ENSMUSG00000021756
AA Change: D881Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184445
SMART Domains Protein: ENSMUSP00000139311
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184949
AA Change: D820Y

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138915
Gene: ENSMUSG00000021756
AA Change: D820Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 9.4e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 442 6.97e0 SMART
FN3 456 539 4.81e-4 SMART
transmembrane domain 557 579 N/A INTRINSIC
low complexity region 657 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggest that this gene plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants have been described. A related pseudogene has been identified on chromosome 17. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations show myocardial and hematological defects and die between embryonic day 12.5 and term. Conditional mutants show female infertility and neurological, cardiac, hematopoietic, immunological, hepatic, and lung defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Cyp2j8 T A 4: 96,447,324 H411L probably benign Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dhrs3 T C 4: 144,893,546 V11A probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
Gtpbp2 A G 17: 46,168,592 R590G probably benign Het
H2-M3 G A 17: 37,271,163 R170H probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Kdm7a A G 6: 39,152,898 V448A probably benign Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Kri1 T C 9: 21,282,211 D140G possibly damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mpp5 T A 12: 78,797,038 Y5* probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Nphp1 G T 2: 127,770,392 P212T probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Phf19 G A 2: 34,911,619 R60W probably damaging Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tas2r118 A G 6: 23,969,261 I267T probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Zfp329 T C 7: 12,810,949 D216G possibly damaging Het
Other mutations in Il6st
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Il6st APN 13 112481433 unclassified probably null
IGL00571:Il6st APN 13 112487860 missense probably damaging 1.00
IGL01151:Il6st APN 13 112493651 missense probably benign 0.00
IGL01336:Il6st APN 13 112480239 missense possibly damaging 0.71
IGL01501:Il6st APN 13 112480059 missense probably benign 0.22
IGL01512:Il6st APN 13 112504366 missense probably benign 0.36
IGL01657:Il6st APN 13 112481543 missense probably damaging 1.00
IGL01863:Il6st APN 13 112504210 missense possibly damaging 0.88
IGL01916:Il6st APN 13 112480072 missense possibly damaging 0.90
IGL01978:Il6st APN 13 112497357 missense possibly damaging 0.51
IGL02089:Il6st APN 13 112495240 missense probably benign 0.12
IGL02752:Il6st APN 13 112480195 missense probably damaging 0.98
IGL02988:Il6st UTSW 13 112498886 missense probably damaging 1.00
R0019:Il6st UTSW 13 112501148 missense possibly damaging 0.94
R0550:Il6st UTSW 13 112475114 splice site probably null
R0606:Il6st UTSW 13 112504272 missense possibly damaging 0.78
R1126:Il6st UTSW 13 112503732 missense probably damaging 1.00
R1452:Il6st UTSW 13 112481464 missense possibly damaging 0.79
R1581:Il6st UTSW 13 112481541 missense probably damaging 0.99
R1881:Il6st UTSW 13 112504413 missense probably damaging 1.00
R2013:Il6st UTSW 13 112498889 missense probably null 0.94
R2043:Il6st UTSW 13 112480219 missense probably benign 0.00
R2128:Il6st UTSW 13 112504175 missense probably benign 0.01
R2137:Il6st UTSW 13 112502858 missense possibly damaging 0.92
R3433:Il6st UTSW 13 112503831 missense probably damaging 1.00
R3696:Il6st UTSW 13 112504382 missense probably benign 0.13
R3697:Il6st UTSW 13 112504382 missense probably benign 0.13
R3698:Il6st UTSW 13 112504382 missense probably benign 0.13
R4172:Il6st UTSW 13 112495327 missense probably benign 0.25
R4543:Il6st UTSW 13 112481459 missense probably damaging 1.00
R4641:Il6st UTSW 13 112488530 missense probably damaging 1.00
R4838:Il6st UTSW 13 112490510 nonsense probably null
R4899:Il6st UTSW 13 112501161 missense probably damaging 1.00
R4922:Il6st UTSW 13 112502865 missense probably damaging 0.98
R5088:Il6st UTSW 13 112490555 missense probably damaging 1.00
R5104:Il6st UTSW 13 112488648 missense probably benign 0.02
R5853:Il6st UTSW 13 112481537 missense probably damaging 1.00
R6602:Il6st UTSW 13 112504413 missense probably damaging 1.00
R7082:Il6st UTSW 13 112504032 missense probably damaging 1.00
R7101:Il6st UTSW 13 112495373 critical splice donor site probably null
R7192:Il6st UTSW 13 112495207 missense probably benign 0.00
R7273:Il6st UTSW 13 112495298 missense probably benign 0.37
R7330:Il6st UTSW 13 112493651 missense probably benign 0.00
R7427:Il6st UTSW 13 112488560 missense probably benign 0.01
R7770:Il6st UTSW 13 112502804 missense probably damaging 1.00
U24488:Il6st UTSW 13 112494634 missense possibly damaging 0.90
Z1176:Il6st UTSW 13 112493618 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCAGGCAACCGTATTTCAAGCAG -3'
(R):5'- TGCCTATCTTCAGGGAGTGAGGAC -3'

Sequencing Primer
(F):5'- AGTCAGCCTGAAGCCTGTC -3'
(R):5'- AGGACTGTTTCTCATCTGAAGCC -3'
Posted On2014-04-24