Incidental Mutation 'R1632:Gtpbp2'
ID172882
Institutional Source Beutler Lab
Gene Symbol Gtpbp2
Ensembl Gene ENSMUSG00000023952
Gene NameGTP binding protein 2
Synonyms
MMRRC Submission 039669-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock #R1632 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46161032-46169370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46168592 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 590 (R590G)
Ref Sequence ENSEMBL: ENSMUSP00000128517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024748] [ENSMUST00000024749] [ENSMUST00000166563] [ENSMUST00000169383] [ENSMUST00000172170]
Predicted Effect probably benign
Transcript: ENSMUST00000024748
SMART Domains Protein: ENSMUSP00000024748
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 412 4.2e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Pfam:GTP_EFTU_D3 499 589 8.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024749
SMART Domains Protein: ENSMUSP00000024749
Gene: ENSMUSG00000023953

DomainStartEndE-ValueType
Pfam:IMS 12 227 9.7e-53 PFAM
Pfam:IMS_C 308 435 5.8e-15 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 540 561 N/A INTRINSIC
PDB:2I5O|A 606 643 7e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163941
Predicted Effect probably benign
Transcript: ENSMUST00000166252
Predicted Effect probably benign
Transcript: ENSMUST00000166563
SMART Domains Protein: ENSMUSP00000127896
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166663
Predicted Effect probably benign
Transcript: ENSMUST00000166701
SMART Domains Protein: ENSMUSP00000131772
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
SCOP:d1f60a2 69 111 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167681
Predicted Effect probably benign
Transcript: ENSMUST00000169383
SMART Domains Protein: ENSMUSP00000133050
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171901
Predicted Effect probably benign
Transcript: ENSMUST00000172170
AA Change: R590G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128517
Gene: ENSMUSG00000023952
AA Change: R590G

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 411 9.4e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GTP-binding proteins, or G proteins, constitute a superfamily capable of binding GTP or GDP. G proteins are activated by binding GTP and are inactivated by hydrolyzing GTP to GDP. This general mechanism enables G proteins to perform a wide range of biologic activities.[supplied by OMIM, Jan 2003]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,290,402 D118G probably damaging Het
AF529169 T A 9: 89,602,360 H328L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 A T 17: 67,849,074 Y696N probably damaging Het
C77080 A G 4: 129,222,666 M735T possibly damaging Het
Cachd1 A G 4: 100,966,972 T537A probably benign Het
Capn15 A T 17: 25,960,665 F841Y probably damaging Het
Card10 G A 15: 78,791,220 R396* probably null Het
Chd9 A T 8: 90,956,707 K592* probably null Het
Cyp2j8 T A 4: 96,447,324 H411L probably benign Het
Dhcr24 G T 4: 106,585,951 M394I probably benign Het
Dhrs3 T C 4: 144,893,546 V11A probably benign Het
Dync1li2 A T 8: 104,437,491 I134N probably damaging Het
Enpp4 G T 17: 44,099,653 S344Y probably damaging Het
Ephb3 T C 16: 21,212,937 S14P probably benign Het
Fancm T G 12: 65,130,331 I1983S probably damaging Het
Fndc1 T C 17: 7,773,200 T555A unknown Het
Gemin4 A T 11: 76,210,989 M982K probably benign Het
H2-M3 G A 17: 37,271,163 R170H probably benign Het
Hoxa13 G T 6: 52,259,937 N278K probably damaging Het
Hspb3 A G 13: 113,663,053 V147A probably benign Het
Il6st G T 13: 112,504,332 D820Y possibly damaging Het
Kdm7a A G 6: 39,152,898 V448A probably benign Het
Kmt2b T C 7: 30,583,962 D991G probably damaging Het
Kri1 T C 9: 21,282,211 D140G possibly damaging Het
Limk2 A G 11: 3,346,250 L399P probably damaging Het
Lrrc9 T A 12: 72,460,020 probably null Het
Map2 C T 1: 66,415,086 T1045M possibly damaging Het
Map4k5 T C 12: 69,828,047 I321V probably benign Het
Mpp5 T A 12: 78,797,038 Y5* probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh7b A G 2: 155,620,525 S383G probably benign Het
Nostrin A G 2: 69,175,734 K254R probably benign Het
Nphp1 G T 2: 127,770,392 P212T probably benign Het
Olfr988 A T 2: 85,353,242 M228K possibly damaging Het
Pclo A C 5: 14,680,003 probably benign Het
Phf19 G A 2: 34,911,619 R60W probably damaging Het
Psg18 G A 7: 18,350,899 P91S probably benign Het
Rttn C T 18: 89,009,336 T525I probably benign Het
Ryr1 T C 7: 29,094,261 M1268V probably benign Het
Slc25a2 T C 18: 37,637,687 E263G possibly damaging Het
Slc32a1 C T 2: 158,613,890 A155V possibly damaging Het
Slc6a19 A T 13: 73,689,908 probably null Het
Socs4 A G 14: 47,289,577 probably benign Het
Tas2r118 A G 6: 23,969,261 I267T probably benign Het
Tpte G A 8: 22,349,347 C470Y probably damaging Het
Usp17la A T 7: 104,860,911 H241L probably benign Het
Vmn2r72 T A 7: 85,751,792 I140F probably benign Het
Zfp329 T C 7: 12,810,949 D216G possibly damaging Het
Other mutations in Gtpbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Gtpbp2 APN 17 46168254 missense probably damaging 1.00
IGL01534:Gtpbp2 APN 17 46163504 missense probably damaging 1.00
IGL02272:Gtpbp2 APN 17 46164781 missense probably benign 0.00
IGL02864:Gtpbp2 APN 17 46165594 missense probably benign 0.00
R0894:Gtpbp2 UTSW 17 46165969 missense possibly damaging 0.85
R1575:Gtpbp2 UTSW 17 46165943 missense probably damaging 1.00
R1639:Gtpbp2 UTSW 17 46165771 splice site probably null
R1786:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2132:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2133:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2223:Gtpbp2 UTSW 17 46167227 missense probably benign
R3742:Gtpbp2 UTSW 17 46165882 missense probably benign 0.03
R4060:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4061:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4064:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4387:Gtpbp2 UTSW 17 46166358 missense probably benign 0.03
R4469:Gtpbp2 UTSW 17 46161313 missense probably damaging 0.99
R4583:Gtpbp2 UTSW 17 46161145 missense probably damaging 0.99
R4664:Gtpbp2 UTSW 17 46161154 missense probably benign 0.33
R4724:Gtpbp2 UTSW 17 46167221 critical splice acceptor site probably null
R5338:Gtpbp2 UTSW 17 46167834 missense probably damaging 1.00
R5368:Gtpbp2 UTSW 17 46166304 splice site probably benign
R5832:Gtpbp2 UTSW 17 46167862 missense probably damaging 0.98
R6490:Gtpbp2 UTSW 17 46168221 missense probably benign 0.01
R6526:Gtpbp2 UTSW 17 46164111 intron probably null
R6723:Gtpbp2 UTSW 17 46168276 missense probably benign 0.05
R6860:Gtpbp2 UTSW 17 46167988 intron probably benign
R7336:Gtpbp2 UTSW 17 46161313 missense probably damaging 0.99
R7662:Gtpbp2 UTSW 17 46166435 missense probably benign 0.00
R7710:Gtpbp2 UTSW 17 46167787 missense possibly damaging 0.92
R8021:Gtpbp2 UTSW 17 46164269 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GATGTACAAGCCATCACAGCAGGAG -3'
(R):5'- TCAACCCAGGATAGGAGCACAGTC -3'

Sequencing Primer
(F):5'- ATGGGCTTCTGAGTCATCCAAAC -3'
(R):5'- AGCACAGTCTGTCATGGTC -3'
Posted On2014-04-24