Incidental Mutation 'R1633:Nipal3'
ID172902
Institutional Source Beutler Lab
Gene Symbol Nipal3
Ensembl Gene ENSMUSG00000028803
Gene NameNIPA-like domain containing 3
Synonyms9130020G22Rik, Npal3
MMRRC Submission 039670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1633 (G1)
Quality Score211
Status Validated
Chromosome4
Chromosomal Location135445420-135495038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 135447348 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 364 (R364L)
Ref Sequence ENSEMBL: ENSMUSP00000139088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102549] [ENSMUST00000105856] [ENSMUST00000183807]
Predicted Effect probably benign
Transcript: ENSMUST00000102549
SMART Domains Protein: ENSMUSP00000099608
Gene: ENSMUSG00000028803

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 33 333 5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105856
AA Change: R364L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101482
Gene: ENSMUSG00000028803
AA Change: R364L

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:Mg_trans_NIPA 35 330 9.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140982
SMART Domains Protein: ENSMUSP00000118178
Gene: ENSMUSG00000028803

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 1 190 1.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183397
Predicted Effect probably benign
Transcript: ENSMUST00000183807
AA Change: R364L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139088
Gene: ENSMUSG00000028803
AA Change: R364L

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 33 333 3.8e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194277
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 83.9%
Validation Efficiency 94% (68/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit gender-dependent behavioral and immune system abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd C T 1: 127,753,855 A185V probably benign Het
Acsl6 T C 11: 54,328,398 probably benign Het
Arel1 A G 12: 84,926,283 F580S probably damaging Het
Arhgef19 T C 4: 141,238,560 probably benign Het
Bpifb3 T A 2: 153,922,584 L132Q probably damaging Het
Cacna2d1 T A 5: 16,320,116 D516E probably damaging Het
Ccar1 T C 10: 62,751,014 R882G unknown Het
Cep162 T C 9: 87,203,683 E1196G probably benign Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Cttnbp2 A T 6: 18,435,167 S231T probably damaging Het
Dgcr14 A G 16: 17,909,967 V116A probably benign Het
Dock8 A G 19: 25,051,563 T44A probably benign Het
Edrf1 T C 7: 133,652,140 S536P probably damaging Het
Eif5 T A 12: 111,540,287 N104K probably damaging Het
Enpp3 T C 10: 24,795,782 Y438C probably damaging Het
Fam208b A T 13: 3,581,771 I910N possibly damaging Het
Galnt4 T C 10: 99,109,952 V513A possibly damaging Het
Gdpd5 T C 7: 99,448,513 I172T probably benign Het
Ggt7 C T 2: 155,502,688 G245D probably damaging Het
Gm5884 A T 6: 128,646,065 noncoding transcript Het
Herc2 G A 7: 56,229,369 G4669R probably null Het
Hydin T A 8: 110,506,982 D1817E probably benign Het
Igf2r A C 17: 12,726,309 N359K probably benign Het
Itgb4 T C 11: 116,007,760 F1722L probably damaging Het
Itih3 T A 14: 30,917,398 E406V possibly damaging Het
Lamc2 A T 1: 153,141,698 C514* probably null Het
Mepe G T 5: 104,337,674 V227F probably benign Het
Nadk C T 4: 155,577,185 T56I probably damaging Het
Nedd4 G A 9: 72,671,257 V84I possibly damaging Het
Nkx2-9 T C 12: 56,612,981 R27G probably benign Het
Noc2l T A 4: 156,245,293 S600T probably benign Het
Olfr15 A C 16: 3,839,532 K186N probably damaging Het
Olfr364-ps1 T A 2: 37,146,971 I253N probably damaging Het
Olfr98 T A 17: 37,263,662 M1L probably benign Het
Pax6 A T 2: 105,691,718 E240V probably damaging Het
Pdilt T G 7: 119,487,994 T478P probably damaging Het
Phldb1 T A 9: 44,718,322 I25F probably damaging Het
Rad50 C T 11: 53,692,859 R365Q probably benign Het
Rdh10 A G 1: 16,128,196 E186G possibly damaging Het
Rdh12 A T 12: 79,218,724 E224V probably damaging Het
Reck T C 4: 43,922,964 V413A possibly damaging Het
Scn8a A G 15: 101,029,815 I1392V probably benign Het
Simc1 G A 13: 54,525,231 G464D probably benign Het
Srf A T 17: 46,551,608 V318E probably damaging Het
Stab1 T C 14: 31,150,380 probably null Het
Stk3 T C 15: 34,959,060 D322G probably damaging Het
Stxbp4 A G 11: 90,540,160 probably benign Het
Sult2a1 A G 7: 13,801,426 I234T probably benign Het
Syne1 A G 10: 5,349,388 F956L probably damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tmem63a T A 1: 180,948,826 V67E probably damaging Het
Tram2 A T 1: 21,003,922 V264E probably damaging Het
Trpv5 A T 6: 41,675,920 C106* probably null Het
Tspyl5 T A 15: 33,686,645 K385* probably null Het
Vezt T A 10: 93,984,276 Q409L probably damaging Het
Vmn2r79 T C 7: 87,037,834 C808R possibly damaging Het
Wdfy3 A C 5: 101,981,548 V4G probably damaging Het
Wdr95 A T 5: 149,593,172 I493F probably damaging Het
Zfhx4 A T 3: 5,400,413 N1877I probably damaging Het
Zfp180 A G 7: 24,104,801 D215G probably benign Het
Zfp442 A T 2: 150,408,340 Y490* probably null Het
Zfp804b A G 5: 7,179,513 probably benign Het
Other mutations in Nipal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Nipal3 APN 4 135468593 missense possibly damaging 0.90
IGL01338:Nipal3 APN 4 135471883 critical splice donor site probably null
IGL02149:Nipal3 APN 4 135466852 missense possibly damaging 0.67
IGL02160:Nipal3 APN 4 135474417 nonsense probably null
IGL02560:Nipal3 APN 4 135479704 missense probably damaging 1.00
IGL02826:Nipal3 APN 4 135468550 nonsense probably null
IGL02868:Nipal3 APN 4 135466871 missense probably damaging 1.00
R0189:Nipal3 UTSW 4 135468518 missense possibly damaging 0.89
R0470:Nipal3 UTSW 4 135447372 missense probably damaging 0.99
R0891:Nipal3 UTSW 4 135468587 missense possibly damaging 0.91
R1686:Nipal3 UTSW 4 135447288 missense possibly damaging 0.49
R2921:Nipal3 UTSW 4 135477465 missense probably damaging 1.00
R2923:Nipal3 UTSW 4 135477465 missense probably damaging 1.00
R3732:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3732:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3733:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3734:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R5057:Nipal3 UTSW 4 135466856 missense probably damaging 1.00
R5616:Nipal3 UTSW 4 135452404 missense probably benign 0.01
R5758:Nipal3 UTSW 4 135452563 missense probably benign 0.02
R5779:Nipal3 UTSW 4 135452339 intron probably benign
R5885:Nipal3 UTSW 4 135471977 missense probably damaging 0.97
R6572:Nipal3 UTSW 4 135447253 missense probably benign 0.02
R6981:Nipal3 UTSW 4 135479547 missense probably damaging 1.00
R7194:Nipal3 UTSW 4 135474421 missense probably benign 0.26
R7537:Nipal3 UTSW 4 135490937 missense probably damaging 1.00
R8018:Nipal3 UTSW 4 135447348 missense possibly damaging 0.63
R8098:Nipal3 UTSW 4 135452398 missense possibly damaging 0.87
R8503:Nipal3 UTSW 4 135479581 missense probably damaging 1.00
X0066:Nipal3 UTSW 4 135447255 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAACTGCCTGCCATGCCCAA -3'
(R):5'- GAAGTGCTCAGACCTTCCTCTCTCA -3'

Sequencing Primer
(F):5'- tcccccagccttccctc -3'
(R):5'- tcattacggatggttgggag -3'
Posted On2014-04-24