Incidental Mutation 'R1633:Pdilt'
ID172919
Institutional Source Beutler Lab
Gene Symbol Pdilt
Ensembl Gene ENSMUSG00000030968
Gene Nameprotein disulfide isomerase-like, testis expressed
SynonymsPDILT, 1700007B13Rik
MMRRC Submission 039670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R1633 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119486587-119523489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119487994 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 478 (T478P)
Ref Sequence ENSEMBL: ENSMUSP00000033267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033267] [ENSMUST00000208275]
Predicted Effect probably damaging
Transcript: ENSMUST00000033267
AA Change: T478P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033267
Gene: ENSMUSG00000030968
AA Change: T478P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
Pfam:Thioredoxin_6 177 362 6e-35 PFAM
Pfam:Thioredoxin 385 489 3.7e-16 PFAM
low complexity region 495 512 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208275
Meta Mutation Damage Score 0.4804 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 83.9%
Validation Efficiency 94% (68/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has has an N-terminal ER-signal sequence, two thioredoxin (TRX) domains with non-classical Ser-Lys-Gln-Ser and Ser-Lys-Lys-Cys motifs, respectively, two TRX-like domains, and a C-terminal ER-retention sequence. The protein lacks oxidoreductase activity in vitro and probably functions as a chaperone. This gene's expression appears to be limited to the testis. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility and abnormal sperm physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd C T 1: 127,753,855 A185V probably benign Het
Acsl6 T C 11: 54,328,398 probably benign Het
Arel1 A G 12: 84,926,283 F580S probably damaging Het
Arhgef19 T C 4: 141,238,560 probably benign Het
Bpifb3 T A 2: 153,922,584 L132Q probably damaging Het
Cacna2d1 T A 5: 16,320,116 D516E probably damaging Het
Ccar1 T C 10: 62,751,014 R882G unknown Het
Cep162 T C 9: 87,203,683 E1196G probably benign Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Cttnbp2 A T 6: 18,435,167 S231T probably damaging Het
Dgcr14 A G 16: 17,909,967 V116A probably benign Het
Dock8 A G 19: 25,051,563 T44A probably benign Het
Edrf1 T C 7: 133,652,140 S536P probably damaging Het
Eif5 T A 12: 111,540,287 N104K probably damaging Het
Enpp3 T C 10: 24,795,782 Y438C probably damaging Het
Fam208b A T 13: 3,581,771 I910N possibly damaging Het
Galnt4 T C 10: 99,109,952 V513A possibly damaging Het
Gdpd5 T C 7: 99,448,513 I172T probably benign Het
Ggt7 C T 2: 155,502,688 G245D probably damaging Het
Gm5884 A T 6: 128,646,065 noncoding transcript Het
Herc2 G A 7: 56,229,369 G4669R probably null Het
Hydin T A 8: 110,506,982 D1817E probably benign Het
Igf2r A C 17: 12,726,309 N359K probably benign Het
Itgb4 T C 11: 116,007,760 F1722L probably damaging Het
Itih3 T A 14: 30,917,398 E406V possibly damaging Het
Lamc2 A T 1: 153,141,698 C514* probably null Het
Mepe G T 5: 104,337,674 V227F probably benign Het
Nadk C T 4: 155,577,185 T56I probably damaging Het
Nedd4 G A 9: 72,671,257 V84I possibly damaging Het
Nipal3 C A 4: 135,447,348 R364L probably benign Het
Nkx2-9 T C 12: 56,612,981 R27G probably benign Het
Noc2l T A 4: 156,245,293 S600T probably benign Het
Olfr15 A C 16: 3,839,532 K186N probably damaging Het
Olfr364-ps1 T A 2: 37,146,971 I253N probably damaging Het
Olfr98 T A 17: 37,263,662 M1L probably benign Het
Pax6 A T 2: 105,691,718 E240V probably damaging Het
Phldb1 T A 9: 44,718,322 I25F probably damaging Het
Rad50 C T 11: 53,692,859 R365Q probably benign Het
Rdh10 A G 1: 16,128,196 E186G possibly damaging Het
Rdh12 A T 12: 79,218,724 E224V probably damaging Het
Reck T C 4: 43,922,964 V413A possibly damaging Het
Scn8a A G 15: 101,029,815 I1392V probably benign Het
Simc1 G A 13: 54,525,231 G464D probably benign Het
Srf A T 17: 46,551,608 V318E probably damaging Het
Stab1 T C 14: 31,150,380 probably null Het
Stk3 T C 15: 34,959,060 D322G probably damaging Het
Stxbp4 A G 11: 90,540,160 probably benign Het
Sult2a1 A G 7: 13,801,426 I234T probably benign Het
Syne1 A G 10: 5,349,388 F956L probably damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tmem63a T A 1: 180,948,826 V67E probably damaging Het
Tram2 A T 1: 21,003,922 V264E probably damaging Het
Trpv5 A T 6: 41,675,920 C106* probably null Het
Tspyl5 T A 15: 33,686,645 K385* probably null Het
Vezt T A 10: 93,984,276 Q409L probably damaging Het
Vmn2r79 T C 7: 87,037,834 C808R possibly damaging Het
Wdfy3 A C 5: 101,981,548 V4G probably damaging Het
Wdr95 A T 5: 149,593,172 I493F probably damaging Het
Zfhx4 A T 3: 5,400,413 N1877I probably damaging Het
Zfp180 A G 7: 24,104,801 D215G probably benign Het
Zfp442 A T 2: 150,408,340 Y490* probably null Het
Zfp804b A G 5: 7,179,513 probably benign Het
Other mutations in Pdilt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Pdilt APN 7 119500444 missense probably damaging 1.00
IGL02102:Pdilt APN 7 119486950 missense probably benign 0.28
IGL02312:Pdilt APN 7 119519667 missense probably benign 0.03
IGL02887:Pdilt APN 7 119498049 missense possibly damaging 0.86
R0670:Pdilt UTSW 7 119500428 missense probably benign 0.03
R0759:Pdilt UTSW 7 119489484 nonsense probably null
R1525:Pdilt UTSW 7 119487994 missense probably damaging 0.99
R1612:Pdilt UTSW 7 119486975 missense possibly damaging 0.95
R1848:Pdilt UTSW 7 119489384 missense probably benign 0.02
R3026:Pdilt UTSW 7 119514954 missense probably benign 0.01
R3546:Pdilt UTSW 7 119500488 nonsense probably null
R4406:Pdilt UTSW 7 119495009 missense probably damaging 1.00
R5331:Pdilt UTSW 7 119514924 missense possibly damaging 0.67
R5459:Pdilt UTSW 7 119486935 missense probably benign 0.01
R5771:Pdilt UTSW 7 119494994 missense probably damaging 0.98
R5807:Pdilt UTSW 7 119500543 unclassified probably benign
R6143:Pdilt UTSW 7 119495042 missense probably damaging 1.00
R6456:Pdilt UTSW 7 119500483 missense probably damaging 0.99
R6850:Pdilt UTSW 7 119486959 missense probably damaging 0.98
R7159:Pdilt UTSW 7 119487951 missense probably benign 0.01
R7676:Pdilt UTSW 7 119494997 missense probably damaging 1.00
R8266:Pdilt UTSW 7 119489381 missense probably benign 0.01
R8282:Pdilt UTSW 7 119498070 missense probably damaging 1.00
R8437:Pdilt UTSW 7 119514886 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCATCTCAGGAATGTGACAAGCGG -3'
(R):5'- GCCATGAGGGTATGTAATCCAGCC -3'

Sequencing Primer
(F):5'- AGCTCACTCAAAGTAGATGGC -3'
(R):5'- tcatgtcccctgatgagagag -3'
Posted On2014-04-24