Incidental Mutation 'R1633:Stk3'
ID 172942
Institutional Source Beutler Lab
Gene Symbol Stk3
Ensembl Gene ENSMUSG00000022329
Gene Name serine/threonine kinase 3
Synonyms mess1, MST, Mst2
MMRRC Submission 039670-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1633 (G1)
Quality Score 177
Status Validated
Chromosome 15
Chromosomal Location 34875496-35178921 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34959060 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 322 (D322G)
Ref Sequence ENSEMBL: ENSMUSP00000018476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018476] [ENSMUST00000067033] [ENSMUST00000226555]
AlphaFold Q9JI10
Predicted Effect probably damaging
Transcript: ENSMUST00000018476
AA Change: D322G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018476
Gene: ENSMUSG00000022329
AA Change: D322G

low complexity region 7 19 N/A INTRINSIC
S_TKc 27 278 4.16e-103 SMART
low complexity region 301 324 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Pfam:Mst1_SARAH 443 490 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067033
AA Change: D252G

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000064225
Gene: ENSMUSG00000022329
AA Change: D252G

Pfam:Pkinase_Tyr 5 205 2.1e-41 PFAM
Pfam:Pkinase 5 208 1.2e-56 PFAM
coiled coil region 217 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Mst1_SARAH 372 420 9.8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128425
Predicted Effect possibly damaging
Transcript: ENSMUST00000226555
AA Change: D320G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226730
Meta Mutation Damage Score 0.1286 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 83.9%
Validation Efficiency 94% (68/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous inactivation of this gene generally results in mice that are viable, fertile and developmentally normal. A small subset of mice homozygous for a knock-out allele develop mammary tumors in the absence of immunological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd C T 1: 127,753,855 A185V probably benign Het
Acsl6 T C 11: 54,328,398 probably benign Het
Arel1 A G 12: 84,926,283 F580S probably damaging Het
Arhgef19 T C 4: 141,238,560 probably benign Het
Bpifb3 T A 2: 153,922,584 L132Q probably damaging Het
Cacna2d1 T A 5: 16,320,116 D516E probably damaging Het
Ccar1 T C 10: 62,751,014 R882G unknown Het
Cep162 T C 9: 87,203,683 E1196G probably benign Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Cttnbp2 A T 6: 18,435,167 S231T probably damaging Het
Dgcr14 A G 16: 17,909,967 V116A probably benign Het
Dock8 A G 19: 25,051,563 T44A probably benign Het
Edrf1 T C 7: 133,652,140 S536P probably damaging Het
Eif5 T A 12: 111,540,287 N104K probably damaging Het
Enpp3 T C 10: 24,795,782 Y438C probably damaging Het
Fam208b A T 13: 3,581,771 I910N possibly damaging Het
Galnt4 T C 10: 99,109,952 V513A possibly damaging Het
Gdpd5 T C 7: 99,448,513 I172T probably benign Het
Ggt7 C T 2: 155,502,688 G245D probably damaging Het
Gm5884 A T 6: 128,646,065 noncoding transcript Het
Herc2 G A 7: 56,229,369 G4669R probably null Het
Hydin T A 8: 110,506,982 D1817E probably benign Het
Igf2r A C 17: 12,726,309 N359K probably benign Het
Itgb4 T C 11: 116,007,760 F1722L probably damaging Het
Itih3 T A 14: 30,917,398 E406V possibly damaging Het
Lamc2 A T 1: 153,141,698 C514* probably null Het
Mepe G T 5: 104,337,674 V227F probably benign Het
Nadk C T 4: 155,577,185 T56I probably damaging Het
Nedd4 G A 9: 72,671,257 V84I possibly damaging Het
Nipal3 C A 4: 135,447,348 R364L probably benign Het
Nkx2-9 T C 12: 56,612,981 R27G probably benign Het
Noc2l T A 4: 156,245,293 S600T probably benign Het
Olfr15 A C 16: 3,839,532 K186N probably damaging Het
Olfr364-ps1 T A 2: 37,146,971 I253N probably damaging Het
Olfr98 T A 17: 37,263,662 M1L probably benign Het
Pax6 A T 2: 105,691,718 E240V probably damaging Het
Pdilt T G 7: 119,487,994 T478P probably damaging Het
Phldb1 T A 9: 44,718,322 I25F probably damaging Het
Rad50 C T 11: 53,692,859 R365Q probably benign Het
Rdh10 A G 1: 16,128,196 E186G possibly damaging Het
Rdh12 A T 12: 79,218,724 E224V probably damaging Het
Reck T C 4: 43,922,964 V413A possibly damaging Het
Scn8a A G 15: 101,029,815 I1392V probably benign Het
Simc1 G A 13: 54,525,231 G464D probably benign Het
Srf A T 17: 46,551,608 V318E probably damaging Het
Stab1 T C 14: 31,150,380 probably null Het
Stxbp4 A G 11: 90,540,160 probably benign Het
Sult2a1 A G 7: 13,801,426 I234T probably benign Het
Syne1 A G 10: 5,349,388 F956L probably damaging Het
Thsd7a G T 6: 12,471,104 S505* probably null Het
Tmem63a T A 1: 180,948,826 V67E probably damaging Het
Tram2 A T 1: 21,003,922 V264E probably damaging Het
Trpv5 A T 6: 41,675,920 C106* probably null Het
Tspyl5 T A 15: 33,686,645 K385* probably null Het
Vezt T A 10: 93,984,276 Q409L probably damaging Het
Vmn2r79 T C 7: 87,037,834 C808R possibly damaging Het
Wdfy3 A C 5: 101,981,548 V4G probably damaging Het
Wdr95 A T 5: 149,593,172 I493F probably damaging Het
Zfhx4 A T 3: 5,400,413 N1877I probably damaging Het
Zfp180 A G 7: 24,104,801 D215G probably benign Het
Zfp442 A T 2: 150,408,340 Y490* probably null Het
Zfp804b A G 5: 7,179,513 probably benign Het
Other mutations in Stk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Stk3 APN 15 35114622 missense possibly damaging 0.93
IGL02133:Stk3 APN 15 35099516 missense probably damaging 1.00
IGL03121:Stk3 APN 15 35099426 splice site probably benign
IGL03309:Stk3 APN 15 35099551 splice site probably benign
R0276:Stk3 UTSW 15 35099469 missense probably damaging 1.00
R0416:Stk3 UTSW 15 35114632 missense probably benign 0.07
R1352:Stk3 UTSW 15 35008225 missense probably damaging 1.00
R1638:Stk3 UTSW 15 35008308 splice site probably null
R1917:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R1919:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R2011:Stk3 UTSW 15 35072498 missense probably damaging 1.00
R2072:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2073:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2075:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R3158:Stk3 UTSW 15 35008241 missense possibly damaging 0.83
R3402:Stk3 UTSW 15 34944998 splice site probably benign
R4633:Stk3 UTSW 15 34958928 missense probably damaging 0.99
R4672:Stk3 UTSW 15 35099457 missense probably benign 0.06
R4687:Stk3 UTSW 15 35114565 missense probably damaging 0.99
R4825:Stk3 UTSW 15 34999908 missense probably benign 0.14
R4903:Stk3 UTSW 15 34959066 missense probably damaging 0.99
R5390:Stk3 UTSW 15 35114560 nonsense probably null
R5834:Stk3 UTSW 15 34959018 missense probably damaging 1.00
R7208:Stk3 UTSW 15 35073116 missense possibly damaging 0.76
R7266:Stk3 UTSW 15 34959036 missense probably benign 0.05
R7862:Stk3 UTSW 15 35115586 missense possibly damaging 0.90
R8354:Stk3 UTSW 15 34876724 missense probably damaging 1.00
R8454:Stk3 UTSW 15 34876724 missense probably damaging 1.00
R8996:Stk3 UTSW 15 34945062 missense possibly damaging 0.51
R9160:Stk3 UTSW 15 35099465 missense probably damaging 0.99
R9366:Stk3 UTSW 15 35072488 missense probably damaging 1.00
R9777:Stk3 UTSW 15 35114645 missense probably damaging 1.00
X0021:Stk3 UTSW 15 35072555 missense probably damaging 1.00
X0060:Stk3 UTSW 15 35114533 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCATAGTTCCGtcctcctcctcc -3'
(R):5'- CGGCCTAatccatattgcagcacag -3'

Sequencing Primer
(F):5'- cctcctcctcctcctcttc -3'
(R):5'- atagcatatcttgctttttgctttc -3'
Posted On 2014-04-24