Incidental Mutation 'R1634:Rgl1'
ID172951
Institutional Source Beutler Lab
Gene Symbol Rgl1
Ensembl Gene ENSMUSG00000026482
Gene Nameral guanine nucleotide dissociation stimulator,-like 1
SynonymsRgl
MMRRC Submission 039671-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R1634 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location152516760-152766351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152524772 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 624 (R624H)
Ref Sequence ENSEMBL: ENSMUSP00000107488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859]
Predicted Effect probably damaging
Transcript: ENSMUST00000027760
AA Change: R626H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: R626H

DomainStartEndE-ValueType
RasGEFN 64 196 5.86e-39 SMART
RasGEF 228 502 9.56e-116 SMART
Blast:RasGEF 522 582 6e-8 BLAST
low complexity region 585 596 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
RA 648 735 1.7e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111857
AA Change: R624H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: R624H

DomainStartEndE-ValueType
RasGEFN 62 194 5.86e-39 SMART
RasGEF 226 500 9.56e-116 SMART
Blast:RasGEF 520 580 7e-8 BLAST
low complexity region 583 594 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
RA 646 733 1.7e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111859
AA Change: R661H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: R661H

DomainStartEndE-ValueType
RasGEFN 99 231 5.86e-39 SMART
RasGEF 263 537 9.56e-116 SMART
Blast:RasGEF 557 617 6e-8 BLAST
low complexity region 620 631 N/A INTRINSIC
low complexity region 662 672 N/A INTRINSIC
RA 683 770 1.7e-25 SMART
Meta Mutation Damage Score 0.4133 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.4%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 A T 14: 66,057,731 F222I probably damaging Het
Adam34 A T 8: 43,652,090 C173S possibly damaging Het
Ahi1 T C 10: 20,965,693 V293A probably damaging Het
AI182371 A T 2: 35,086,485 Y223N probably damaging Het
Armc4 A G 18: 7,286,688 L181P probably damaging Het
Asmt C A X: 170,675,829 F181L probably damaging Het
Axin1 T A 17: 26,187,991 H519Q probably damaging Het
Cdc5l A T 17: 45,404,706 V660E probably damaging Het
Cep152 C T 2: 125,583,889 R852H probably benign Het
Cpne4 T C 9: 104,989,579 V230A possibly damaging Het
Cttnbp2 A T 6: 18,408,657 N988K probably benign Het
D430041D05Rik A G 2: 104,221,211 I767T probably damaging Het
Dgki A G 6: 36,915,490 M851T probably benign Het
Dnah8 T C 17: 30,713,098 probably null Het
Dscaml1 A G 9: 45,672,749 E504G probably damaging Het
Dzank1 G A 2: 144,481,669 A618V probably benign Het
Fam189b A C 3: 89,188,094 Y511S probably damaging Het
Fat2 T A 11: 55,267,684 S3403C probably damaging Het
Fat2 C T 11: 55,284,719 V1723I probably benign Het
Flt1 A T 5: 147,676,430 F334I probably damaging Het
Galnt12 G T 4: 47,108,585 probably null Het
Gzmc T C 14: 56,232,280 I188V possibly damaging Het
Herc1 T C 9: 66,473,538 S3566P possibly damaging Het
Hoxb4 C A 11: 96,320,273 probably benign Het
Idh3b C T 2: 130,281,745 V141I probably benign Het
Kif24 A G 4: 41,393,529 S1249P probably benign Het
Leo1 T C 9: 75,466,260 Y656H possibly damaging Het
Map3k20 G A 2: 72,410,177 W339* probably null Het
Map3k5 T C 10: 20,136,911 V1259A possibly damaging Het
Masp2 A G 4: 148,614,355 D631G probably damaging Het
Mink1 T C 11: 70,608,880 S713P probably benign Het
Mpp7 A T 18: 7,350,984 V571E possibly damaging Het
Nell1 A G 7: 50,848,558 D574G possibly damaging Het
Obscn T C 11: 59,076,896 Y392C probably damaging Het
Olfml2a A T 2: 38,960,219 Y649F probably benign Het
Olfr1295 T C 2: 111,565,346 M33V probably benign Het
Olfr161 A G 16: 3,593,209 D271G probably benign Het
Prkcg A G 7: 3,323,470 D484G probably damaging Het
Rab27a T C 9: 73,075,569 probably null Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Ric8b G A 10: 84,970,748 G159D probably damaging Het
Sbno2 C A 10: 80,060,634 A880S possibly damaging Het
Scn9a A G 2: 66,488,017 S1477P probably damaging Het
Sec22a T C 16: 35,318,873 probably benign Het
Snx14 T C 9: 88,385,739 I714M probably benign Het
Snx14 T C 9: 88,407,490 probably benign Het
Sphk2 T A 7: 45,711,540 T347S probably benign Het
Spns1 C T 7: 126,371,171 probably benign Het
Susd2 A G 10: 75,637,555 V675A probably benign Het
Sytl2 A T 7: 90,395,182 D566V probably damaging Het
Tcf25 T A 8: 123,397,091 I464N possibly damaging Het
Tex261 A T 6: 83,775,022 I49N possibly damaging Het
Tjp1 A G 7: 65,302,952 F1545L possibly damaging Het
Tmem176b A G 6: 48,834,566 S216P probably damaging Het
Topaz1 C T 9: 122,780,675 probably benign Het
Tra2a C T 6: 49,250,957 probably benign Het
Ttn A G 2: 76,722,782 F22794S possibly damaging Het
Uox G A 3: 146,612,383 W93* probably null Het
Zan A T 5: 137,412,790 probably benign Het
Zfp106 G A 2: 120,533,677 R750* probably null Het
Zfp638 A T 6: 83,979,912 probably null Het
Other mutations in Rgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Rgl1 APN 1 152571617 missense probably benign 0.02
IGL01065:Rgl1 APN 1 152519142 missense probably damaging 1.00
IGL01390:Rgl1 APN 1 152571588 splice site probably benign
IGL01726:Rgl1 APN 1 152519153 missense probably damaging 1.00
IGL01837:Rgl1 APN 1 152549150 missense probably damaging 1.00
IGL02019:Rgl1 APN 1 152528469 splice site probably benign
IGL02369:Rgl1 APN 1 152533606 missense probably damaging 1.00
R0240:Rgl1 UTSW 1 152554424 unclassified probably benign
R0255:Rgl1 UTSW 1 152552596 missense probably damaging 1.00
R0562:Rgl1 UTSW 1 152539945 missense probably damaging 1.00
R0648:Rgl1 UTSW 1 152536265 critical splice donor site probably null
R0734:Rgl1 UTSW 1 152554300 missense probably damaging 0.98
R1187:Rgl1 UTSW 1 152544433 missense probably benign 0.14
R1522:Rgl1 UTSW 1 152586533 missense probably damaging 1.00
R1595:Rgl1 UTSW 1 152675023 splice site probably benign
R1661:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R1665:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R1964:Rgl1 UTSW 1 152549104 missense probably damaging 1.00
R2291:Rgl1 UTSW 1 152536281 missense probably damaging 1.00
R4272:Rgl1 UTSW 1 152536289 missense probably benign 0.13
R4668:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4669:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4747:Rgl1 UTSW 1 152524699 nonsense probably null
R4830:Rgl1 UTSW 1 152554330 missense probably benign 0.11
R4853:Rgl1 UTSW 1 152557574 missense probably benign 0.07
R4969:Rgl1 UTSW 1 152549062 splice site probably null
R5778:Rgl1 UTSW 1 152552421 missense probably benign 0.05
R5979:Rgl1 UTSW 1 152557493 missense probably damaging 1.00
R6180:Rgl1 UTSW 1 152519172 missense probably damaging 1.00
R6183:Rgl1 UTSW 1 152586570 missense possibly damaging 0.94
R6322:Rgl1 UTSW 1 152552435 missense probably damaging 0.98
R6678:Rgl1 UTSW 1 152524724 missense probably damaging 1.00
R6759:Rgl1 UTSW 1 152533530 missense probably damaging 0.99
R6892:Rgl1 UTSW 1 152539940 missense probably benign 0.00
R7290:Rgl1 UTSW 1 152544395 missense possibly damaging 0.78
R7363:Rgl1 UTSW 1 152519163 missense probably damaging 1.00
R7610:Rgl1 UTSW 1 152552620 missense probably damaging 1.00
Z1088:Rgl1 UTSW 1 152675020 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TACCACTAATCTGCGCCCAGGAAG -3'
(R):5'- TCACTGATCGTCACATGAGCCCAC -3'

Sequencing Primer
(F):5'- AAGACGCTGCTATTTTCCATGC -3'
(R):5'- tgtgtgtACCAGAGACATGAG -3'
Posted On2014-04-24