Mutagenetix > Incidental Mutations

Incidental Mutation 'R1634:Rgl1'

172951

Institutional Source

Beutler Lab

Gene Symbol

Rgl1

Ensembl Gene

ENSMUSG00000026482

Gene Name

ral guanine nucleotide dissociation stimulator,-like 1

Synonyms

Rgl

MMRRC Submission

039671-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.370) question?

Stock #

R1634 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

152516760-152766351 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 152524772 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 624 (R624H)

Ref Sequence

ENSEMBL: ENSMUSP00000107488 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027760
AA Change: R626H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: R626H

Domain	Start	End	E-Value	Type
RasGEFN	64	196	5.86e-39	SMART
RasGEF	228	502	9.56e-116	SMART
Blast:RasGEF	522	582	6e-8	BLAST
low complexity region	585	596	N/A	INTRINSIC
low complexity region	627	637	N/A	INTRINSIC
RA	648	735	1.7e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111857
AA Change: R624H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: R624H

Domain	Start	End	E-Value	Type
RasGEFN	62	194	5.86e-39	SMART
RasGEF	226	500	9.56e-116	SMART
Blast:RasGEF	520	580	7e-8	BLAST
low complexity region	583	594	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
RA	646	733	1.7e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111859
AA Change: R661H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: R661H

Domain	Start	End	E-Value	Type
RasGEFN	99	231	5.86e-39	SMART
RasGEF	263	537	9.56e-116	SMART
Blast:RasGEF	557	617	6e-8	BLAST
low complexity region	620	631	N/A	INTRINSIC
low complexity region	662	672	N/A	INTRINSIC
RA	683	770	1.7e-25	SMART

Meta Mutation Damage Score

0.4133

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.4%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam2	A	T	14: 66,057,731	F222I	probably damaging	Het
Adam34	A	T	8: 43,652,090	C173S	possibly damaging	Het
Ahi1	T	C	10: 20,965,693	V293A	probably damaging	Het
AI182371	A	T	2: 35,086,485	Y223N	probably damaging	Het
Armc4	A	G	18: 7,286,688	L181P	probably damaging	Het
Asmt	C	A	X: 170,675,829	F181L	probably damaging	Het
Axin1	T	A	17: 26,187,991	H519Q	probably damaging	Het
Cdc5l	A	T	17: 45,404,706	V660E	probably damaging	Het
Cep152	C	T	2: 125,583,889	R852H	probably benign	Het
Cpne4	T	C	9: 104,989,579	V230A	possibly damaging	Het
Cttnbp2	A	T	6: 18,408,657	N988K	probably benign	Het
D430041D05Rik	A	G	2: 104,221,211	I767T	probably damaging	Het
Dgki	A	G	6: 36,915,490	M851T	probably benign	Het
Dnah8	T	C	17: 30,713,098		probably null	Het
Dscaml1	A	G	9: 45,672,749	E504G	probably damaging	Het
Dzank1	G	A	2: 144,481,669	A618V	probably benign	Het
Fam189b	A	C	3: 89,188,094	Y511S	probably damaging	Het
Fat2	T	A	11: 55,267,684	S3403C	probably damaging	Het
Fat2	C	T	11: 55,284,719	V1723I	probably benign	Het
Flt1	A	T	5: 147,676,430	F334I	probably damaging	Het
Galnt12	G	T	4: 47,108,585		probably null	Het
Gzmc	T	C	14: 56,232,280	I188V	possibly damaging	Het
Herc1	T	C	9: 66,473,538	S3566P	possibly damaging	Het
Hoxb4	C	A	11: 96,320,273		probably benign	Het
Idh3b	C	T	2: 130,281,745	V141I	probably benign	Het
Kif24	A	G	4: 41,393,529	S1249P	probably benign	Het
Leo1	T	C	9: 75,466,260	Y656H	possibly damaging	Het
Map3k20	G	A	2: 72,410,177	W339*	probably null	Het
Map3k5	T	C	10: 20,136,911	V1259A	possibly damaging	Het
Masp2	A	G	4: 148,614,355	D631G	probably damaging	Het
Mink1	T	C	11: 70,608,880	S713P	probably benign	Het
Mpp7	A	T	18: 7,350,984	V571E	possibly damaging	Het
Nell1	A	G	7: 50,848,558	D574G	possibly damaging	Het
Obscn	T	C	11: 59,076,896	Y392C	probably damaging	Het
Olfml2a	A	T	2: 38,960,219	Y649F	probably benign	Het
Olfr1295	T	C	2: 111,565,346	M33V	probably benign	Het
Olfr161	A	G	16: 3,593,209	D271G	probably benign	Het
Prkcg	A	G	7: 3,323,470	D484G	probably damaging	Het
Rab27a	T	C	9: 73,075,569		probably null	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Ric8b	G	A	10: 84,970,748	G159D	probably damaging	Het
Sbno2	C	A	10: 80,060,634	A880S	possibly damaging	Het
Scn9a	A	G	2: 66,488,017	S1477P	probably damaging	Het
Sec22a	T	C	16: 35,318,873		probably benign	Het
Snx14	T	C	9: 88,385,739	I714M	probably benign	Het
Snx14	T	C	9: 88,407,490		probably benign	Het
Sphk2	T	A	7: 45,711,540	T347S	probably benign	Het
Spns1	C	T	7: 126,371,171		probably benign	Het
Susd2	A	G	10: 75,637,555	V675A	probably benign	Het
Sytl2	A	T	7: 90,395,182	D566V	probably damaging	Het
Tcf25	T	A	8: 123,397,091	I464N	possibly damaging	Het
Tex261	A	T	6: 83,775,022	I49N	possibly damaging	Het
Tjp1	A	G	7: 65,302,952	F1545L	possibly damaging	Het
Tmem176b	A	G	6: 48,834,566	S216P	probably damaging	Het
Topaz1	C	T	9: 122,780,675		probably benign	Het
Tra2a	C	T	6: 49,250,957		probably benign	Het
Ttn	A	G	2: 76,722,782	F22794S	possibly damaging	Het
Uox	G	A	3: 146,612,383	W93*	probably null	Het
Zan	A	T	5: 137,412,790		probably benign	Het
Zfp106	G	A	2: 120,533,677	R750*	probably null	Het
Zfp638	A	T	6: 83,979,912		probably null	Het

Other mutations in Rgl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Rgl1	APN	1	152571617	missense	probably benign	0.02
IGL01065:Rgl1	APN	1	152519142	missense	probably damaging	1.00
IGL01390:Rgl1	APN	1	152571588	splice site	probably benign
IGL01726:Rgl1	APN	1	152519153	missense	probably damaging	1.00
IGL01837:Rgl1	APN	1	152549150	missense	probably damaging	1.00
IGL02019:Rgl1	APN	1	152528469	splice site	probably benign
IGL02369:Rgl1	APN	1	152533606	missense	probably damaging	1.00
R0240:Rgl1	UTSW	1	152554424	unclassified	probably benign
R0255:Rgl1	UTSW	1	152552596	missense	probably damaging	1.00
R0562:Rgl1	UTSW	1	152539945	missense	probably damaging	1.00
R0648:Rgl1	UTSW	1	152536265	critical splice donor site	probably null
R0734:Rgl1	UTSW	1	152554300	missense	probably damaging	0.98
R1187:Rgl1	UTSW	1	152544433	missense	probably benign	0.14
R1522:Rgl1	UTSW	1	152586533	missense	probably damaging	1.00
R1595:Rgl1	UTSW	1	152675023	splice site	probably benign
R1661:Rgl1	UTSW	1	152533575	missense	probably damaging	0.99
R1665:Rgl1	UTSW	1	152533575	missense	probably damaging	0.99
R1964:Rgl1	UTSW	1	152549104	missense	probably damaging	1.00
R2291:Rgl1	UTSW	1	152536281	missense	probably damaging	1.00
R4272:Rgl1	UTSW	1	152536289	missense	probably benign	0.13
R4668:Rgl1	UTSW	1	152521371	missense	probably damaging	1.00
R4669:Rgl1	UTSW	1	152521371	missense	probably damaging	1.00
R4747:Rgl1	UTSW	1	152524699	nonsense	probably null
R4830:Rgl1	UTSW	1	152554330	missense	probably benign	0.11
R4853:Rgl1	UTSW	1	152557574	missense	probably benign	0.07
R4969:Rgl1	UTSW	1	152549062	splice site	probably null
R5778:Rgl1	UTSW	1	152552421	missense	probably benign	0.05
R5979:Rgl1	UTSW	1	152557493	missense	probably damaging	1.00
R6180:Rgl1	UTSW	1	152519172	missense	probably damaging	1.00
R6183:Rgl1	UTSW	1	152586570	missense	possibly damaging	0.94
R6322:Rgl1	UTSW	1	152552435	missense	probably damaging	0.98
R6678:Rgl1	UTSW	1	152524724	missense	probably damaging	1.00
R6759:Rgl1	UTSW	1	152533530	missense	probably damaging	0.99
R6892:Rgl1	UTSW	1	152539940	missense	probably benign	0.00
R7290:Rgl1	UTSW	1	152544395	missense	possibly damaging	0.78
R7363:Rgl1	UTSW	1	152519163	missense	probably damaging	1.00
R7610:Rgl1	UTSW	1	152552620	missense	probably damaging	1.00
R7774:Rgl1	UTSW	1	152554350	missense	probably benign
R8140:Rgl1	UTSW	1	152557501	missense	probably damaging	1.00
RF005:Rgl1	UTSW	1	152521363	missense	probably benign
Z1088:Rgl1	UTSW	1	152675020	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TACCACTAATCTGCGCCCAGGAAG -3'
(R):5'- TCACTGATCGTCACATGAGCCCAC -3'

Sequencing Primer
(F):5'- AAGACGCTGCTATTTTCCATGC -3'
(R):5'- tgtgtgtACCAGAGACATGAG -3'

Posted On

2014-04-24