Incidental Mutation 'R1634:Scn9a'
ID172954
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Namesodium channel, voltage-gated, type IX, alpha
SynonymsPN1
MMRRC Submission 039671-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1634 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location66480080-66634962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66488017 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1477 (S1477P)
Ref Sequence ENSEMBL: ENSMUSP00000131711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
Predicted Effect probably damaging
Transcript: ENSMUST00000100063
AA Change: S1479P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: S1479P

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100064
AA Change: S1488P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: S1488P

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112354
AA Change: S1477P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: S1477P

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152740
Predicted Effect probably damaging
Transcript: ENSMUST00000164384
AA Change: S1488P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: S1488P

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169900
AA Change: S1477P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: S1477P

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.4%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 A T 14: 66,057,731 F222I probably damaging Het
Adam34 A T 8: 43,652,090 C173S possibly damaging Het
Ahi1 T C 10: 20,965,693 V293A probably damaging Het
AI182371 A T 2: 35,086,485 Y223N probably damaging Het
Armc4 A G 18: 7,286,688 L181P probably damaging Het
Asmt C A X: 170,675,829 F181L probably damaging Het
Axin1 T A 17: 26,187,991 H519Q probably damaging Het
Cdc5l A T 17: 45,404,706 V660E probably damaging Het
Cep152 C T 2: 125,583,889 R852H probably benign Het
Cpne4 T C 9: 104,989,579 V230A possibly damaging Het
Cttnbp2 A T 6: 18,408,657 N988K probably benign Het
D430041D05Rik A G 2: 104,221,211 I767T probably damaging Het
Dgki A G 6: 36,915,490 M851T probably benign Het
Dnah8 T C 17: 30,713,098 probably null Het
Dscaml1 A G 9: 45,672,749 E504G probably damaging Het
Dzank1 G A 2: 144,481,669 A618V probably benign Het
Fam189b A C 3: 89,188,094 Y511S probably damaging Het
Fat2 T A 11: 55,267,684 S3403C probably damaging Het
Fat2 C T 11: 55,284,719 V1723I probably benign Het
Flt1 A T 5: 147,676,430 F334I probably damaging Het
Galnt12 G T 4: 47,108,585 probably null Het
Gzmc T C 14: 56,232,280 I188V possibly damaging Het
Herc1 T C 9: 66,473,538 S3566P possibly damaging Het
Hoxb4 C A 11: 96,320,273 probably benign Het
Idh3b C T 2: 130,281,745 V141I probably benign Het
Kif24 A G 4: 41,393,529 S1249P probably benign Het
Leo1 T C 9: 75,466,260 Y656H possibly damaging Het
Map3k20 G A 2: 72,410,177 W339* probably null Het
Map3k5 T C 10: 20,136,911 V1259A possibly damaging Het
Masp2 A G 4: 148,614,355 D631G probably damaging Het
Mink1 T C 11: 70,608,880 S713P probably benign Het
Mpp7 A T 18: 7,350,984 V571E possibly damaging Het
Nell1 A G 7: 50,848,558 D574G possibly damaging Het
Obscn T C 11: 59,076,896 Y392C probably damaging Het
Olfml2a A T 2: 38,960,219 Y649F probably benign Het
Olfr1295 T C 2: 111,565,346 M33V probably benign Het
Olfr161 A G 16: 3,593,209 D271G probably benign Het
Prkcg A G 7: 3,323,470 D484G probably damaging Het
Rab27a T C 9: 73,075,569 probably null Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rgl1 C T 1: 152,524,772 R624H probably damaging Het
Ric8b G A 10: 84,970,748 G159D probably damaging Het
Sbno2 C A 10: 80,060,634 A880S possibly damaging Het
Sec22a T C 16: 35,318,873 probably benign Het
Snx14 T C 9: 88,385,739 I714M probably benign Het
Snx14 T C 9: 88,407,490 probably benign Het
Sphk2 T A 7: 45,711,540 T347S probably benign Het
Spns1 C T 7: 126,371,171 probably benign Het
Susd2 A G 10: 75,637,555 V675A probably benign Het
Sytl2 A T 7: 90,395,182 D566V probably damaging Het
Tcf25 T A 8: 123,397,091 I464N possibly damaging Het
Tex261 A T 6: 83,775,022 I49N possibly damaging Het
Tjp1 A G 7: 65,302,952 F1545L possibly damaging Het
Tmem176b A G 6: 48,834,566 S216P probably damaging Het
Topaz1 C T 9: 122,780,675 probably benign Het
Tra2a C T 6: 49,250,957 probably benign Het
Ttn A G 2: 76,722,782 F22794S possibly damaging Het
Uox G A 3: 146,612,383 W93* probably null Het
Zan A T 5: 137,412,790 probably benign Het
Zfp106 G A 2: 120,533,677 R750* probably null Het
Zfp638 A T 6: 83,979,912 probably null Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66563601 missense probably damaging 1.00
IGL00570:Scn9a APN 2 66484142 missense probably damaging 1.00
IGL00809:Scn9a APN 2 66483935 missense probably damaging 1.00
IGL00977:Scn9a APN 2 66484301 missense probably damaging 0.99
IGL01120:Scn9a APN 2 66526972 missense probably benign 0.00
IGL01134:Scn9a APN 2 66504968 missense probably damaging 1.00
IGL01300:Scn9a APN 2 66488053 nonsense probably null
IGL01452:Scn9a APN 2 66527072 missense probably damaging 1.00
IGL01531:Scn9a APN 2 66537378 missense probably benign 0.11
IGL01572:Scn9a APN 2 66493886 missense probably benign 0.00
IGL01645:Scn9a APN 2 66487642 missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66484042 missense probably damaging 1.00
IGL01965:Scn9a APN 2 66484433 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66547135 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66494826 missense probably damaging 1.00
IGL02166:Scn9a APN 2 66493103 missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66484611 splice site probably benign
IGL02640:Scn9a APN 2 66536096 critical splice donor site probably null
IGL02685:Scn9a APN 2 66537293 missense probably damaging 1.00
IGL02798:Scn9a APN 2 66540559 missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66568029 missense probably damaging 1.00
IGL03008:Scn9a APN 2 66562511 missense probably damaging 1.00
IGL03270:Scn9a APN 2 66484014 missense probably damaging 1.00
IGL03408:Scn9a APN 2 66526747 missense probably benign 0.00
R0039:Scn9a UTSW 2 66562444 missense probably damaging 0.98
R0173:Scn9a UTSW 2 66533093 missense probably damaging 1.00
R0323:Scn9a UTSW 2 66568131 missense probably damaging 1.00
R0344:Scn9a UTSW 2 66505010 missense probably damaging 0.99
R0421:Scn9a UTSW 2 66543277 missense probably benign
R0465:Scn9a UTSW 2 66526996 missense probably damaging 1.00
R0514:Scn9a UTSW 2 66483678 missense probably damaging 1.00
R0599:Scn9a UTSW 2 66526799 missense probably damaging 0.96
R0627:Scn9a UTSW 2 66537377 missense probably benign 0.00
R0644:Scn9a UTSW 2 66533061 critical splice donor site probably null
R0653:Scn9a UTSW 2 66533377 missense probably damaging 1.00
R0685:Scn9a UTSW 2 66483499 missense probably benign 0.02
R0718:Scn9a UTSW 2 66547112 missense probably damaging 1.00
R0827:Scn9a UTSW 2 66536124 nonsense probably null
R0890:Scn9a UTSW 2 66483735 missense probably damaging 1.00
R1139:Scn9a UTSW 2 66504997 missense probably benign 0.02
R1385:Scn9a UTSW 2 66563542 missense probably damaging 1.00
R1398:Scn9a UTSW 2 66484586 missense probably benign 0.11
R1496:Scn9a UTSW 2 66526888 missense probably benign
R1511:Scn9a UTSW 2 66526813 missense probably benign 0.01
R1517:Scn9a UTSW 2 66505027 splice site probably benign
R1564:Scn9a UTSW 2 66484304 missense probably damaging 1.00
R1662:Scn9a UTSW 2 66483459 missense probably benign 0.00
R1695:Scn9a UTSW 2 66504876 nonsense probably null
R1709:Scn9a UTSW 2 66483506 missense probably damaging 1.00
R1741:Scn9a UTSW 2 66487594 missense probably damaging 0.99
R1755:Scn9a UTSW 2 66501716 missense probably benign 0.38
R1914:Scn9a UTSW 2 66566250 missense probably damaging 1.00
R1962:Scn9a UTSW 2 66484311 missense probably damaging 1.00
R1970:Scn9a UTSW 2 66515380 missense probably damaging 0.97
R2017:Scn9a UTSW 2 66515321 missense probably damaging 0.99
R2092:Scn9a UTSW 2 66533376 missense probably damaging 0.99
R2105:Scn9a UTSW 2 66568183 missense probably benign 0.25
R2114:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2115:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2128:Scn9a UTSW 2 66526654 missense probably damaging 1.00
R2157:Scn9a UTSW 2 66536325 missense probably damaging 1.00
R2162:Scn9a UTSW 2 66534229 missense probably damaging 0.98
R2350:Scn9a UTSW 2 66504968 missense probably damaging 1.00
R3694:Scn9a UTSW 2 66562405 missense probably benign
R3771:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3772:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3773:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3922:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66565054 intron probably benign
R4385:Scn9a UTSW 2 66484556 missense probably damaging 1.00
R4415:Scn9a UTSW 2 66526693 missense probably damaging 1.00
R4570:Scn9a UTSW 2 66483558 missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66547018 missense probably benign
R4783:Scn9a UTSW 2 66540623 missense probably benign 0.01
R4822:Scn9a UTSW 2 66483749 missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66551713 missense probably benign
R4908:Scn9a UTSW 2 66526743 missense probably benign 0.03
R4983:Scn9a UTSW 2 66566270 missense probably benign 0.02
R5047:Scn9a UTSW 2 66562480 missense probably damaging 1.00
R5100:Scn9a UTSW 2 66534119 missense probably damaging 1.00
R5140:Scn9a UTSW 2 66565167 missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66488043 missense probably damaging 1.00
R5557:Scn9a UTSW 2 66547103 missense probably damaging 0.99
R5582:Scn9a UTSW 2 66565029 intron probably benign
R6108:Scn9a UTSW 2 66484049 missense probably damaging 1.00
R6115:Scn9a UTSW 2 66563629 missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66487524 missense probably benign 0.00
R6261:Scn9a UTSW 2 66483896 missense probably damaging 1.00
R6335:Scn9a UTSW 2 66568264 start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66526963 missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66483502 missense probably benign 0.23
R6681:Scn9a UTSW 2 66563342 missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66568029 missense probably damaging 1.00
R7102:Scn9a UTSW 2 66549015 missense probably damaging 1.00
R7186:Scn9a UTSW 2 66534223 missense probably damaging 1.00
R7243:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R7311:Scn9a UTSW 2 66484404 missense possibly damaging 0.54
R7328:Scn9a UTSW 2 66484587 missense probably benign
R7386:Scn9a UTSW 2 66540550 missense probably damaging 1.00
R7438:Scn9a UTSW 2 66547187 missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66533348 missense probably damaging 0.99
R7485:Scn9a UTSW 2 66534217 missense probably damaging 1.00
R7526:Scn9a UTSW 2 66483646 missense probably benign
R7617:Scn9a UTSW 2 66540549 missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66536236 missense probably benign 0.02
R7653:Scn9a UTSW 2 66527080 missense probably damaging 1.00
R7747:Scn9a UTSW 2 66484298 missense probably damaging 1.00
R7823:Scn9a UTSW 2 66483791 missense probably damaging 1.00
X0003:Scn9a UTSW 2 66508647 missense probably benign 0.02
X0062:Scn9a UTSW 2 66568077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTGAGCCTACAACGGTTCTGAG -3'
(R):5'- GAGCCCTACTTGCAATGAGAGTCC -3'

Sequencing Primer
(F):5'- CTACAACGGTTCTGAGAGAGGC -3'
(R):5'- TGAGAGTCCTAAACATGTGCC -3'
Posted On2014-04-24