Mutagenetix > Incidental Mutation

Incidental Mutation 'R1634:Uox'

172965

Institutional Source

Beutler Lab

Gene Symbol

Uox

Ensembl Gene

ENSMUSG00000028186

Gene Name

urate oxidase

Synonyms

MMRRC Submission

039671-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.520) question?

Stock #

R1634 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

146570426-146632305 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 146612383 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 93 (W93*)

Ref Sequence

ENSEMBL: ENSMUSP00000143418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029837] [ENSMUST00000121133] [ENSMUST00000147409] [ENSMUST00000199489] [ENSMUST00000200633]

AlphaFold

P25688

Predicted Effect

probably null
Transcript: ENSMUST00000029837
AA Change: W117*

SMART Domains

Protein: ENSMUSP00000029837
Gene: ENSMUSG00000028186
AA Change: W117*

Domain	Start	End	E-Value	Type
Pfam:Uricase	19	144	8.7e-25	PFAM
Pfam:Uricase	153	292	5.6e-38	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000121133
AA Change: W44*

SMART Domains

Protein: ENSMUSP00000113649
Gene: ENSMUSG00000028186
AA Change: W44*

Domain	Start	End	E-Value	Type
Pfam:Uricase	2	72	1.2e-19	PFAM
Pfam:Uricase	79	181	8.5e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138921

Predicted Effect

probably benign
Transcript: ENSMUST00000147409

SMART Domains

Protein: ENSMUSP00000143299
Gene: ENSMUSG00000028186

Domain	Start	End	E-Value	Type
Pfam:Uricase	1	73	1.1e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197320

Predicted Effect

probably null
Transcript: ENSMUST00000199489
AA Change: W93*

SMART Domains

Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186
AA Change: W93*

Domain	Start	End	E-Value	Type
Pfam:Uricase	1	121	8.3e-35	PFAM
Pfam:Uricase	128	228	1.8e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200633

SMART Domains

Protein: ENSMUSP00000142872
Gene: ENSMUSG00000028185

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:DNase_II	26	353	4.5e-117	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.4%

Validation Efficiency

97% (67/69)

MGI Phenotype

PHENOTYPE: Homozygous null mutants exhibit marked hyperuricemia and urate nephropathy. Most mutants die prior to four weeks of age. Homozygotes for a large paracentric inversion disrupting this same gene exhibit a similar phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam2	A	T	14: 66,057,731	F222I	probably damaging	Het
Adam34	A	T	8: 43,652,090	C173S	possibly damaging	Het
Ahi1	T	C	10: 20,965,693	V293A	probably damaging	Het
AI182371	A	T	2: 35,086,485	Y223N	probably damaging	Het
Armc4	A	G	18: 7,286,688	L181P	probably damaging	Het
Asmt	C	A	X: 170,675,829	F181L	probably damaging	Het
Axin1	T	A	17: 26,187,991	H519Q	probably damaging	Het
Cdc5l	A	T	17: 45,404,706	V660E	probably damaging	Het
Cep152	C	T	2: 125,583,889	R852H	probably benign	Het
Cpne4	T	C	9: 104,989,579	V230A	possibly damaging	Het
Cttnbp2	A	T	6: 18,408,657	N988K	probably benign	Het
D430041D05Rik	A	G	2: 104,221,211	I767T	probably damaging	Het
Dgki	A	G	6: 36,915,490	M851T	probably benign	Het
Dnah8	T	C	17: 30,713,098		probably null	Het
Dscaml1	A	G	9: 45,672,749	E504G	probably damaging	Het
Dzank1	G	A	2: 144,481,669	A618V	probably benign	Het
Fam189b	A	C	3: 89,188,094	Y511S	probably damaging	Het
Fat2	T	A	11: 55,267,684	S3403C	probably damaging	Het
Fat2	C	T	11: 55,284,719	V1723I	probably benign	Het
Flt1	A	T	5: 147,676,430	F334I	probably damaging	Het
Galnt12	G	T	4: 47,108,585		probably null	Het
Gzmc	T	C	14: 56,232,280	I188V	possibly damaging	Het
Herc1	T	C	9: 66,473,538	S3566P	possibly damaging	Het
Hoxb4	C	A	11: 96,320,273		probably benign	Het
Idh3b	C	T	2: 130,281,745	V141I	probably benign	Het
Kif24	A	G	4: 41,393,529	S1249P	probably benign	Het
Leo1	T	C	9: 75,466,260	Y656H	possibly damaging	Het
Map3k20	G	A	2: 72,410,177	W339*	probably null	Het
Map3k5	T	C	10: 20,136,911	V1259A	possibly damaging	Het
Masp2	A	G	4: 148,614,355	D631G	probably damaging	Het
Mink1	T	C	11: 70,608,880	S713P	probably benign	Het
Mpp7	A	T	18: 7,350,984	V571E	possibly damaging	Het
Nell1	A	G	7: 50,848,558	D574G	possibly damaging	Het
Obscn	T	C	11: 59,076,896	Y392C	probably damaging	Het
Olfml2a	A	T	2: 38,960,219	Y649F	probably benign	Het
Olfr1295	T	C	2: 111,565,346	M33V	probably benign	Het
Olfr161	A	G	16: 3,593,209	D271G	probably benign	Het
Prkcg	A	G	7: 3,323,470	D484G	probably damaging	Het
Rab27a	T	C	9: 73,075,569		probably null	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rgl1	C	T	1: 152,524,772	R624H	probably damaging	Het
Ric8b	G	A	10: 84,970,748	G159D	probably damaging	Het
Sbno2	C	A	10: 80,060,634	A880S	possibly damaging	Het
Scn9a	A	G	2: 66,488,017	S1477P	probably damaging	Het
Sec22a	T	C	16: 35,318,873		probably benign	Het
Snx14	T	C	9: 88,385,739	I714M	probably benign	Het
Snx14	T	C	9: 88,407,490		probably benign	Het
Sphk2	T	A	7: 45,711,540	T347S	probably benign	Het
Spns1	C	T	7: 126,371,171		probably benign	Het
Susd2	A	G	10: 75,637,555	V675A	probably benign	Het
Sytl2	A	T	7: 90,395,182	D566V	probably damaging	Het
Tcf25	T	A	8: 123,397,091	I464N	possibly damaging	Het
Tex261	A	T	6: 83,775,022	I49N	possibly damaging	Het
Tjp1	A	G	7: 65,302,952	F1545L	possibly damaging	Het
Tmem176b	A	G	6: 48,834,566	S216P	probably damaging	Het
Topaz1	C	T	9: 122,780,675		probably benign	Het
Tra2a	C	T	6: 49,250,957		probably benign	Het
Ttn	A	G	2: 76,722,782	F22794S	possibly damaging	Het
Zan	A	T	5: 137,412,790		probably benign	Het
Zfp106	G	A	2: 120,533,677	R750*	probably null	Het
Zfp638	A	T	6: 83,979,912		probably null	Het

Other mutations in Uox

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Uox	APN	3	146627810	missense	probably benign	0.00
IGL00902:Uox	APN	3	146610406	missense	possibly damaging	0.95
IGL02409:Uox	APN	3	146624626	missense	probably benign	0.06
IGL02827:Uox	APN	3	146597196	intron	probably benign
IGL02979:Uox	APN	3	146610491	splice site	probably null
IGL03375:Uox	APN	3	146625835	missense	probably damaging	1.00
kamloops	UTSW	3	146624577	nonsense	probably null
vancouver	UTSW	3	146612292	missense	probably damaging	1.00
R1350:Uox	UTSW	3	146624575	missense	probably damaging	1.00
R1900:Uox	UTSW	3	146610379	missense	probably damaging	1.00
R2000:Uox	UTSW	3	146610399	missense	possibly damaging	0.65
R2119:Uox	UTSW	3	146612542	missense	probably benign	0.01
R5329:Uox	UTSW	3	146624545	missense	probably damaging	1.00
R5606:Uox	UTSW	3	146610302	nonsense	probably null
R6281:Uox	UTSW	3	146624577	nonsense	probably null
R6327:Uox	UTSW	3	146624577	nonsense	probably null
R6337:Uox	UTSW	3	146624577	nonsense	probably null
R6364:Uox	UTSW	3	146624577	nonsense	probably null
R6365:Uox	UTSW	3	146624577	nonsense	probably null
R6369:Uox	UTSW	3	146624577	nonsense	probably null
R6483:Uox	UTSW	3	146624577	nonsense	probably null
R6492:Uox	UTSW	3	146624577	nonsense	probably null
R6494:Uox	UTSW	3	146624577	nonsense	probably null
R6556:Uox	UTSW	3	146624648	critical splice donor site	probably null
R6803:Uox	UTSW	3	146612509	missense	possibly damaging	0.91
R7809:Uox	UTSW	3	146627858	nonsense	probably null
R7868:Uox	UTSW	3	146610274	missense	probably benign	0.01
R8131:Uox	UTSW	3	146625834	missense	probably damaging	1.00
R8931:Uox	UTSW	3	146612292	missense	probably damaging	1.00
R9088:Uox	UTSW	3	146624614	missense	probably damaging	1.00
R9566:Uox	UTSW	3	146624553	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- GGATGTTTGCCTGGCCTAAACTTTG -3'
(R):5'- TCTCATCTGCTCCACCTCACAGAAG -3'

Sequencing Primer
(F):5'- agccccaaactcaaaacaaac -3'
(R):5'- TCACAGAAGTGCGTTCCC -3'

Posted On

2014-04-24