Mutagenetix > Incidental Mutation

Incidental Mutation 'R1634:Ahi1'

172997

Institutional Source

Beutler Lab

Gene Symbol

Ahi1

Ensembl Gene

ENSMUSG00000019986

Gene Name

Abelson helper integration site 1

Synonyms

1700015F03Rik, Jouberin, D10Bwg0629e, Ahi-1

MMRRC Submission

039671-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.874) question?

Stock #

R1634 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20952547-21080429 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20965693 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 293 (V293A)

Ref Sequence

ENSEMBL: ENSMUSP00000149010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000213104]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105525
AA Change: V293A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: V293A

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC
low complexity region	85	106	N/A	INTRINSIC
low complexity region	148	159	N/A	INTRINSIC
WD40	448	490	4.3e-1	SMART
WD40	493	532	9.3e-9	SMART
WD40	537	576	2.48e-4	SMART
WD40	583	622	6.09e-4	SMART
WD40	641	678	1.9e2	SMART
WD40	684	721	3.98e0	SMART
WD40	724	769	9.51e1	SMART
SH3	905	961	2.15e-21	SMART
low complexity region	975	989	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000213104
AA Change: V293A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.2010

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.4%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam2	A	T	14: 66,057,731	F222I	probably damaging	Het
Adam34	A	T	8: 43,652,090	C173S	possibly damaging	Het
AI182371	A	T	2: 35,086,485	Y223N	probably damaging	Het
Armc4	A	G	18: 7,286,688	L181P	probably damaging	Het
Asmt	C	A	X: 170,675,829	F181L	probably damaging	Het
Axin1	T	A	17: 26,187,991	H519Q	probably damaging	Het
Cdc5l	A	T	17: 45,404,706	V660E	probably damaging	Het
Cep152	C	T	2: 125,583,889	R852H	probably benign	Het
Cpne4	T	C	9: 104,989,579	V230A	possibly damaging	Het
Cttnbp2	A	T	6: 18,408,657	N988K	probably benign	Het
D430041D05Rik	A	G	2: 104,221,211	I767T	probably damaging	Het
Dgki	A	G	6: 36,915,490	M851T	probably benign	Het
Dnah8	T	C	17: 30,713,098		probably null	Het
Dscaml1	A	G	9: 45,672,749	E504G	probably damaging	Het
Dzank1	G	A	2: 144,481,669	A618V	probably benign	Het
Fam189b	A	C	3: 89,188,094	Y511S	probably damaging	Het
Fat2	T	A	11: 55,267,684	S3403C	probably damaging	Het
Fat2	C	T	11: 55,284,719	V1723I	probably benign	Het
Flt1	A	T	5: 147,676,430	F334I	probably damaging	Het
Galnt12	G	T	4: 47,108,585		probably null	Het
Gzmc	T	C	14: 56,232,280	I188V	possibly damaging	Het
Herc1	T	C	9: 66,473,538	S3566P	possibly damaging	Het
Hoxb4	C	A	11: 96,320,273		probably benign	Het
Idh3b	C	T	2: 130,281,745	V141I	probably benign	Het
Kif24	A	G	4: 41,393,529	S1249P	probably benign	Het
Leo1	T	C	9: 75,466,260	Y656H	possibly damaging	Het
Map3k20	G	A	2: 72,410,177	W339*	probably null	Het
Map3k5	T	C	10: 20,136,911	V1259A	possibly damaging	Het
Masp2	A	G	4: 148,614,355	D631G	probably damaging	Het
Mink1	T	C	11: 70,608,880	S713P	probably benign	Het
Mpp7	A	T	18: 7,350,984	V571E	possibly damaging	Het
Nell1	A	G	7: 50,848,558	D574G	possibly damaging	Het
Obscn	T	C	11: 59,076,896	Y392C	probably damaging	Het
Olfml2a	A	T	2: 38,960,219	Y649F	probably benign	Het
Olfr1295	T	C	2: 111,565,346	M33V	probably benign	Het
Olfr161	A	G	16: 3,593,209	D271G	probably benign	Het
Prkcg	A	G	7: 3,323,470	D484G	probably damaging	Het
Rab27a	T	C	9: 73,075,569		probably null	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rgl1	C	T	1: 152,524,772	R624H	probably damaging	Het
Ric8b	G	A	10: 84,970,748	G159D	probably damaging	Het
Sbno2	C	A	10: 80,060,634	A880S	possibly damaging	Het
Scn9a	A	G	2: 66,488,017	S1477P	probably damaging	Het
Sec22a	T	C	16: 35,318,873		probably benign	Het
Snx14	T	C	9: 88,385,739	I714M	probably benign	Het
Snx14	T	C	9: 88,407,490		probably benign	Het
Sphk2	T	A	7: 45,711,540	T347S	probably benign	Het
Spns1	C	T	7: 126,371,171		probably benign	Het
Susd2	A	G	10: 75,637,555	V675A	probably benign	Het
Sytl2	A	T	7: 90,395,182	D566V	probably damaging	Het
Tcf25	T	A	8: 123,397,091	I464N	possibly damaging	Het
Tex261	A	T	6: 83,775,022	I49N	possibly damaging	Het
Tjp1	A	G	7: 65,302,952	F1545L	possibly damaging	Het
Tmem176b	A	G	6: 48,834,566	S216P	probably damaging	Het
Topaz1	C	T	9: 122,780,675		probably benign	Het
Tra2a	C	T	6: 49,250,957		probably benign	Het
Ttn	A	G	2: 76,722,782	F22794S	possibly damaging	Het
Uox	G	A	3: 146,612,383	W93*	probably null	Het
Zan	A	T	5: 137,412,790		probably benign	Het
Zfp106	G	A	2: 120,533,677	R750*	probably null	Het
Zfp638	A	T	6: 83,979,912		probably null	Het

Other mutations in Ahi1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ahi1	APN	10	20972141	missense	probably damaging	1.00
IGL00914:Ahi1	APN	10	20984299	splice site	probably null
IGL01075:Ahi1	APN	10	20987025	missense	possibly damaging	0.80
IGL01094:Ahi1	APN	10	20972060	missense	probably damaging	0.99
IGL01128:Ahi1	APN	10	21074433	missense	probably benign
IGL01527:Ahi1	APN	10	20960085	splice site	probably benign
IGL01821:Ahi1	APN	10	21041243	critical splice donor site	probably null
IGL02159:Ahi1	APN	10	21058177	missense	probably benign	0.13
IGL02176:Ahi1	APN	10	20970916	missense	probably benign	0.00
IGL02200:Ahi1	APN	10	20981314	splice site	probably benign
IGL02232:Ahi1	APN	10	20981375	missense	probably damaging	1.00
IGL02305:Ahi1	APN	10	20970897	missense	probably benign	0.00
IGL02323:Ahi1	APN	10	20972034	missense	probably damaging	1.00
IGL02885:Ahi1	APN	10	21055113	missense	possibly damaging	0.61
IGL02958:Ahi1	APN	10	20963799	missense	probably damaging	1.00
IGL02971:Ahi1	APN	10	21000551	missense	possibly damaging	0.93
IGL03109:Ahi1	APN	10	20970942	missense	probably benign	0.00
IGL03192:Ahi1	APN	10	20965635	missense	probably benign	0.00
IGL03377:Ahi1	APN	10	21018004	missense	possibly damaging	0.51
arisen	UTSW	10	21007768	missense	possibly damaging	0.53
urspringt	UTSW	10	20984393	missense	probably damaging	1.00
P4717OSA:Ahi1	UTSW	10	20972110	missense	probably damaging	1.00
P4748:Ahi1	UTSW	10	20972110	missense	probably damaging	1.00
R0448:Ahi1	UTSW	10	20972075	missense	probably damaging	1.00
R0559:Ahi1	UTSW	10	21000719	splice site	probably benign
R0627:Ahi1	UTSW	10	20965522	missense	probably benign	0.10
R0652:Ahi1	UTSW	10	20979461	missense	probably damaging	1.00
R0690:Ahi1	UTSW	10	20970843	splice site	probably benign
R1209:Ahi1	UTSW	10	20963730	missense	probably damaging	0.98
R1364:Ahi1	UTSW	10	20972156	missense	probably damaging	0.97
R1510:Ahi1	UTSW	10	20959800	missense	probably benign	0.00
R1789:Ahi1	UTSW	10	20963115	missense	probably benign	0.18
R1818:Ahi1	UTSW	10	20988562	missense	probably damaging	1.00
R2069:Ahi1	UTSW	10	20959996	missense	probably damaging	0.98
R2148:Ahi1	UTSW	10	20970976	missense	possibly damaging	0.64
R2566:Ahi1	UTSW	10	20970911	nonsense	probably null
R2850:Ahi1	UTSW	10	21000593	missense	probably benign	0.07
R2862:Ahi1	UTSW	10	20981408	missense	probably damaging	0.99
R3969:Ahi1	UTSW	10	20959947	missense	probably damaging	1.00
R4430:Ahi1	UTSW	10	20972078	missense	probably damaging	1.00
R4496:Ahi1	UTSW	10	20965545	missense	probably benign	0.07
R4755:Ahi1	UTSW	10	21055047	missense	possibly damaging	0.94
R4916:Ahi1	UTSW	10	20984404	missense	probably damaging	1.00
R5216:Ahi1	UTSW	10	20960076	missense	probably benign	0.00
R5223:Ahi1	UTSW	10	20970919	missense	possibly damaging	0.79
R5224:Ahi1	UTSW	10	20987022	missense	probably damaging	1.00
R5604:Ahi1	UTSW	10	20987005	missense	probably damaging	1.00
R5665:Ahi1	UTSW	10	21055047	missense	possibly damaging	0.94
R5704:Ahi1	UTSW	10	21074427	missense	probably benign
R5769:Ahi1	UTSW	10	20960082	critical splice donor site	probably null
R5899:Ahi1	UTSW	10	21000566	missense	probably benign	0.06
R5936:Ahi1	UTSW	10	20965933	missense	probably damaging	1.00
R5969:Ahi1	UTSW	10	20984393	missense	probably damaging	1.00
R6066:Ahi1	UTSW	10	20959926	missense	possibly damaging	0.84
R6122:Ahi1	UTSW	10	21058165	missense	probably benign	0.26
R6135:Ahi1	UTSW	10	20969121	missense	probably benign	0.01
R6240:Ahi1	UTSW	10	20977081	missense	probably damaging	1.00
R6387:Ahi1	UTSW	10	20969043	missense	probably damaging	1.00
R6395:Ahi1	UTSW	10	20979592	missense	possibly damaging	0.49
R6406:Ahi1	UTSW	10	20977049	missense	probably damaging	1.00
R6440:Ahi1	UTSW	10	20960082	critical splice donor site	probably benign
R6558:Ahi1	UTSW	10	20963673	missense	probably damaging	1.00
R6744:Ahi1	UTSW	10	20965567	missense	probably damaging	1.00
R6755:Ahi1	UTSW	10	21017913	missense	probably damaging	0.98
R6927:Ahi1	UTSW	10	21055069	missense	probably damaging	1.00
R6932:Ahi1	UTSW	10	20963691	missense	probably benign	0.02
R6967:Ahi1	UTSW	10	20988625	missense	probably damaging	0.98
R7168:Ahi1	UTSW	10	21017932	missense	probably benign	0.01
R7169:Ahi1	UTSW	10	21055019	missense	probably damaging	1.00
R7327:Ahi1	UTSW	10	20987077	missense	probably damaging	0.99
R7351:Ahi1	UTSW	10	20965933	missense	probably damaging	1.00
R7489:Ahi1	UTSW	10	20963750	missense	probably benign	0.35
R7680:Ahi1	UTSW	10	21007768	missense	possibly damaging	0.53
R7878:Ahi1	UTSW	10	20981431	critical splice donor site	probably null
R7999:Ahi1	UTSW	10	20965681	missense	probably benign	0.31
R8219:Ahi1	UTSW	10	21074436	missense	probably benign	0.00
R8248:Ahi1	UTSW	10	20972092	missense	probably benign	0.04
R8560:Ahi1	UTSW	10	20959915	missense	probably benign	0.04
R8926:Ahi1	UTSW	10	21055083	missense	probably damaging	1.00
R8965:Ahi1	UTSW	10	20963862	missense	probably benign
R8987:Ahi1	UTSW	10	20963784	missense	probably damaging	1.00
R9013:Ahi1	UTSW	10	21007759	missense	probably benign	0.28
R9145:Ahi1	UTSW	10	21000589	missense	probably benign	0.01
R9365:Ahi1	UTSW	10	20972136	missense	probably damaging	0.99
R9567:Ahi1	UTSW	10	20981401	missense	possibly damaging	0.95
X0024:Ahi1	UTSW	10	21000592	missense	possibly damaging	0.69
Z1177:Ahi1	UTSW	10	21041007	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTTTGTCTTTGAACAGTGAACGTCC -3'
(R):5'- AGCCACACTCTTGGTTTTGAACCTC -3'

Sequencing Primer
(F):5'- GAACAGTGAACGTCCTGTTTC -3'
(R):5'- CCATGCTTAAAAAGTCAAGAATCTG -3'

Posted On

2014-04-24