Incidental Mutation 'R1634:Ahi1'
ID 172997
Institutional Source Beutler Lab
Gene Symbol Ahi1
Ensembl Gene ENSMUSG00000019986
Gene Name Abelson helper integration site 1
Synonyms Jouberin, Ahi-1, D10Bwg0629e, 1700015F03Rik
MMRRC Submission 039671-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.866) question?
Stock # R1634 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 20828446-20956328 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20841592 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 293 (V293A)
Ref Sequence ENSEMBL: ENSMUSP00000149010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000213104]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000105525
AA Change: V293A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: V293A

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
WD40 448 490 4.3e-1 SMART
WD40 493 532 9.3e-9 SMART
WD40 537 576 2.48e-4 SMART
WD40 583 622 6.09e-4 SMART
WD40 641 678 1.9e2 SMART
WD40 684 721 3.98e0 SMART
WD40 724 769 9.51e1 SMART
SH3 905 961 2.15e-21 SMART
low complexity region 975 989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213104
AA Change: V293A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.2010 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.4%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 A T 14: 66,295,180 (GRCm39) F222I probably damaging Het
Adam34 A T 8: 44,105,127 (GRCm39) C173S possibly damaging Het
AI182371 A T 2: 34,976,497 (GRCm39) Y223N probably damaging Het
Asmt C A X: 169,109,564 (GRCm39) F181L probably damaging Het
Axin1 T A 17: 26,406,965 (GRCm39) H519Q probably damaging Het
Cdc5l A T 17: 45,715,632 (GRCm39) V660E probably damaging Het
Cep152 C T 2: 125,425,809 (GRCm39) R852H probably benign Het
Cpne4 T C 9: 104,866,778 (GRCm39) V230A possibly damaging Het
Cttnbp2 A T 6: 18,408,656 (GRCm39) N988K probably benign Het
D430041D05Rik A G 2: 104,051,556 (GRCm39) I767T probably damaging Het
Dgki A G 6: 36,892,425 (GRCm39) M851T probably benign Het
Dnah8 T C 17: 30,932,072 (GRCm39) probably null Het
Dscaml1 A G 9: 45,584,047 (GRCm39) E504G probably damaging Het
Dzank1 G A 2: 144,323,589 (GRCm39) A618V probably benign Het
Entrep3 A C 3: 89,095,401 (GRCm39) Y511S probably damaging Het
Fat2 T A 11: 55,158,510 (GRCm39) S3403C probably damaging Het
Fat2 C T 11: 55,175,545 (GRCm39) V1723I probably benign Het
Flt1 A T 5: 147,613,240 (GRCm39) F334I probably damaging Het
Galnt12 G T 4: 47,108,585 (GRCm39) probably null Het
Gzmc T C 14: 56,469,737 (GRCm39) I188V possibly damaging Het
Herc1 T C 9: 66,380,820 (GRCm39) S3566P possibly damaging Het
Hoxb4 C A 11: 96,211,099 (GRCm39) probably benign Het
Idh3b C T 2: 130,123,665 (GRCm39) V141I probably benign Het
Kif24 A G 4: 41,393,529 (GRCm39) S1249P probably benign Het
Leo1 T C 9: 75,373,542 (GRCm39) Y656H possibly damaging Het
Map3k20 G A 2: 72,240,521 (GRCm39) W339* probably null Het
Map3k5 T C 10: 20,012,657 (GRCm39) V1259A possibly damaging Het
Masp2 A G 4: 148,698,812 (GRCm39) D631G probably damaging Het
Mink1 T C 11: 70,499,706 (GRCm39) S713P probably benign Het
Mpp7 A T 18: 7,350,984 (GRCm39) V571E possibly damaging Het
Nell1 A G 7: 50,498,306 (GRCm39) D574G possibly damaging Het
Obscn T C 11: 58,967,722 (GRCm39) Y392C probably damaging Het
Odad2 A G 18: 7,286,688 (GRCm39) L181P probably damaging Het
Olfml2a A T 2: 38,850,231 (GRCm39) Y649F probably benign Het
Or1f19 A G 16: 3,411,073 (GRCm39) D271G probably benign Het
Or4k45 T C 2: 111,395,691 (GRCm39) M33V probably benign Het
Prkcg A G 7: 3,371,986 (GRCm39) D484G probably damaging Het
Rab27a T C 9: 72,982,851 (GRCm39) probably null Het
Rapgef6 TG TGG 11: 54,437,223 (GRCm39) probably null Het
Rgl1 C T 1: 152,400,523 (GRCm39) R624H probably damaging Het
Ric8b G A 10: 84,806,612 (GRCm39) G159D probably damaging Het
Sbno2 C A 10: 79,896,468 (GRCm39) A880S possibly damaging Het
Scn9a A G 2: 66,318,361 (GRCm39) S1477P probably damaging Het
Sec22a T C 16: 35,139,243 (GRCm39) probably benign Het
Snx14 T C 9: 88,267,792 (GRCm39) I714M probably benign Het
Snx14 T C 9: 88,289,543 (GRCm39) probably benign Het
Sphk2 T A 7: 45,360,964 (GRCm39) T347S probably benign Het
Spns1 C T 7: 125,970,343 (GRCm39) probably benign Het
Susd2 A G 10: 75,473,389 (GRCm39) V675A probably benign Het
Sytl2 A T 7: 90,044,390 (GRCm39) D566V probably damaging Het
Tcf25 T A 8: 124,123,830 (GRCm39) I464N possibly damaging Het
Tex261 A T 6: 83,752,004 (GRCm39) I49N possibly damaging Het
Tjp1 A G 7: 64,952,700 (GRCm39) F1545L possibly damaging Het
Tmem176b A G 6: 48,811,500 (GRCm39) S216P probably damaging Het
Topaz1 C T 9: 122,609,740 (GRCm39) probably benign Het
Tra2a C T 6: 49,227,891 (GRCm39) probably benign Het
Ttn A G 2: 76,553,126 (GRCm39) F22794S possibly damaging Het
Uox G A 3: 146,318,138 (GRCm39) W93* probably null Het
Zan A T 5: 137,411,052 (GRCm39) probably benign Het
Zfp106 G A 2: 120,364,158 (GRCm39) R750* probably null Het
Zfp638 A T 6: 83,956,894 (GRCm39) probably null Het
Other mutations in Ahi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ahi1 APN 10 20,848,040 (GRCm39) missense probably damaging 1.00
IGL00914:Ahi1 APN 10 20,860,198 (GRCm39) splice site probably null
IGL01075:Ahi1 APN 10 20,862,924 (GRCm39) missense possibly damaging 0.80
IGL01094:Ahi1 APN 10 20,847,959 (GRCm39) missense probably damaging 0.99
IGL01128:Ahi1 APN 10 20,950,332 (GRCm39) missense probably benign
IGL01527:Ahi1 APN 10 20,835,984 (GRCm39) splice site probably benign
IGL01821:Ahi1 APN 10 20,917,142 (GRCm39) critical splice donor site probably null
IGL02159:Ahi1 APN 10 20,934,076 (GRCm39) missense probably benign 0.13
IGL02176:Ahi1 APN 10 20,846,815 (GRCm39) missense probably benign 0.00
IGL02200:Ahi1 APN 10 20,857,213 (GRCm39) splice site probably benign
IGL02232:Ahi1 APN 10 20,857,274 (GRCm39) missense probably damaging 1.00
IGL02305:Ahi1 APN 10 20,846,796 (GRCm39) missense probably benign 0.00
IGL02323:Ahi1 APN 10 20,847,933 (GRCm39) missense probably damaging 1.00
IGL02885:Ahi1 APN 10 20,931,012 (GRCm39) missense possibly damaging 0.61
IGL02958:Ahi1 APN 10 20,839,698 (GRCm39) missense probably damaging 1.00
IGL02971:Ahi1 APN 10 20,876,450 (GRCm39) missense possibly damaging 0.93
IGL03109:Ahi1 APN 10 20,846,841 (GRCm39) missense probably benign 0.00
IGL03192:Ahi1 APN 10 20,841,534 (GRCm39) missense probably benign 0.00
IGL03377:Ahi1 APN 10 20,893,903 (GRCm39) missense possibly damaging 0.51
arisen UTSW 10 20,883,667 (GRCm39) missense possibly damaging 0.53
urspringt UTSW 10 20,860,292 (GRCm39) missense probably damaging 1.00
P4717OSA:Ahi1 UTSW 10 20,848,009 (GRCm39) missense probably damaging 1.00
P4748:Ahi1 UTSW 10 20,848,009 (GRCm39) missense probably damaging 1.00
R0448:Ahi1 UTSW 10 20,847,974 (GRCm39) missense probably damaging 1.00
R0559:Ahi1 UTSW 10 20,876,618 (GRCm39) splice site probably benign
R0627:Ahi1 UTSW 10 20,841,421 (GRCm39) missense probably benign 0.10
R0652:Ahi1 UTSW 10 20,855,360 (GRCm39) missense probably damaging 1.00
R0690:Ahi1 UTSW 10 20,846,742 (GRCm39) splice site probably benign
R1209:Ahi1 UTSW 10 20,839,629 (GRCm39) missense probably damaging 0.98
R1364:Ahi1 UTSW 10 20,848,055 (GRCm39) missense probably damaging 0.97
R1510:Ahi1 UTSW 10 20,835,699 (GRCm39) missense probably benign 0.00
R1789:Ahi1 UTSW 10 20,839,014 (GRCm39) missense probably benign 0.18
R1818:Ahi1 UTSW 10 20,864,461 (GRCm39) missense probably damaging 1.00
R2069:Ahi1 UTSW 10 20,835,895 (GRCm39) missense probably damaging 0.98
R2148:Ahi1 UTSW 10 20,846,875 (GRCm39) missense possibly damaging 0.64
R2566:Ahi1 UTSW 10 20,846,810 (GRCm39) nonsense probably null
R2850:Ahi1 UTSW 10 20,876,492 (GRCm39) missense probably benign 0.07
R2862:Ahi1 UTSW 10 20,857,307 (GRCm39) missense probably damaging 0.99
R3969:Ahi1 UTSW 10 20,835,846 (GRCm39) missense probably damaging 1.00
R4430:Ahi1 UTSW 10 20,847,977 (GRCm39) missense probably damaging 1.00
R4496:Ahi1 UTSW 10 20,841,444 (GRCm39) missense probably benign 0.07
R4755:Ahi1 UTSW 10 20,930,946 (GRCm39) missense possibly damaging 0.94
R4916:Ahi1 UTSW 10 20,860,303 (GRCm39) missense probably damaging 1.00
R5216:Ahi1 UTSW 10 20,835,975 (GRCm39) missense probably benign 0.00
R5223:Ahi1 UTSW 10 20,846,818 (GRCm39) missense possibly damaging 0.79
R5224:Ahi1 UTSW 10 20,862,921 (GRCm39) missense probably damaging 1.00
R5604:Ahi1 UTSW 10 20,862,904 (GRCm39) missense probably damaging 1.00
R5665:Ahi1 UTSW 10 20,930,946 (GRCm39) missense possibly damaging 0.94
R5704:Ahi1 UTSW 10 20,950,326 (GRCm39) missense probably benign
R5769:Ahi1 UTSW 10 20,835,981 (GRCm39) critical splice donor site probably null
R5899:Ahi1 UTSW 10 20,876,465 (GRCm39) missense probably benign 0.06
R5936:Ahi1 UTSW 10 20,841,832 (GRCm39) missense probably damaging 1.00
R5969:Ahi1 UTSW 10 20,860,292 (GRCm39) missense probably damaging 1.00
R6066:Ahi1 UTSW 10 20,835,825 (GRCm39) missense possibly damaging 0.84
R6122:Ahi1 UTSW 10 20,934,064 (GRCm39) missense probably benign 0.26
R6135:Ahi1 UTSW 10 20,845,020 (GRCm39) missense probably benign 0.01
R6240:Ahi1 UTSW 10 20,852,980 (GRCm39) missense probably damaging 1.00
R6387:Ahi1 UTSW 10 20,844,942 (GRCm39) missense probably damaging 1.00
R6395:Ahi1 UTSW 10 20,855,491 (GRCm39) missense possibly damaging 0.49
R6406:Ahi1 UTSW 10 20,852,948 (GRCm39) missense probably damaging 1.00
R6440:Ahi1 UTSW 10 20,835,981 (GRCm39) critical splice donor site probably benign
R6558:Ahi1 UTSW 10 20,839,572 (GRCm39) missense probably damaging 1.00
R6744:Ahi1 UTSW 10 20,841,466 (GRCm39) missense probably damaging 1.00
R6755:Ahi1 UTSW 10 20,893,812 (GRCm39) missense probably damaging 0.98
R6927:Ahi1 UTSW 10 20,930,968 (GRCm39) missense probably damaging 1.00
R6932:Ahi1 UTSW 10 20,839,590 (GRCm39) missense probably benign 0.02
R6967:Ahi1 UTSW 10 20,864,524 (GRCm39) missense probably damaging 0.98
R7168:Ahi1 UTSW 10 20,893,831 (GRCm39) missense probably benign 0.01
R7169:Ahi1 UTSW 10 20,930,918 (GRCm39) missense probably damaging 1.00
R7327:Ahi1 UTSW 10 20,862,976 (GRCm39) missense probably damaging 0.99
R7351:Ahi1 UTSW 10 20,841,832 (GRCm39) missense probably damaging 1.00
R7489:Ahi1 UTSW 10 20,839,649 (GRCm39) missense probably benign 0.35
R7680:Ahi1 UTSW 10 20,883,667 (GRCm39) missense possibly damaging 0.53
R7878:Ahi1 UTSW 10 20,857,330 (GRCm39) critical splice donor site probably null
R7999:Ahi1 UTSW 10 20,841,580 (GRCm39) missense probably benign 0.31
R8219:Ahi1 UTSW 10 20,950,335 (GRCm39) missense probably benign 0.00
R8248:Ahi1 UTSW 10 20,847,991 (GRCm39) missense probably benign 0.04
R8560:Ahi1 UTSW 10 20,835,814 (GRCm39) missense probably benign 0.04
R8926:Ahi1 UTSW 10 20,930,982 (GRCm39) missense probably damaging 1.00
R8965:Ahi1 UTSW 10 20,839,761 (GRCm39) missense probably benign
R8987:Ahi1 UTSW 10 20,839,683 (GRCm39) missense probably damaging 1.00
R9013:Ahi1 UTSW 10 20,883,658 (GRCm39) missense probably benign 0.28
R9145:Ahi1 UTSW 10 20,876,488 (GRCm39) missense probably benign 0.01
R9365:Ahi1 UTSW 10 20,848,035 (GRCm39) missense probably damaging 0.99
R9567:Ahi1 UTSW 10 20,857,300 (GRCm39) missense possibly damaging 0.95
X0024:Ahi1 UTSW 10 20,876,491 (GRCm39) missense possibly damaging 0.69
Z1177:Ahi1 UTSW 10 20,916,906 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- GCTTTGTCTTTGAACAGTGAACGTCC -3'
(R):5'- AGCCACACTCTTGGTTTTGAACCTC -3'

Sequencing Primer
(F):5'- GAACAGTGAACGTCCTGTTTC -3'
(R):5'- CCATGCTTAAAAAGTCAAGAATCTG -3'
Posted On 2014-04-24