Incidental Mutation 'R1634:Hoxb4'
ID173006
Institutional Source Beutler Lab
Gene Symbol Hoxb4
Ensembl Gene ENSMUSG00000038692
Gene Namehomeobox B4
SynonymsHox-2.6
MMRRC Submission 039671-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.811) question?
Stock #R1634 (G1)
Quality Score94
Status Not validated
Chromosome11
Chromosomal Location96318267-96321638 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 96320273 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049241] [ENSMUST00000093944]
Predicted Effect unknown
Transcript: ENSMUST00000049241
AA Change: A233E
SMART Domains Protein: ENSMUSP00000048002
Gene: ENSMUSG00000038692
AA Change: A233E

DomainStartEndE-ValueType
low complexity region 71 87 N/A INTRINSIC
low complexity region 113 120 N/A INTRINSIC
HOX 161 223 2.83e-26 SMART
low complexity region 230 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083585
Predicted Effect probably benign
Transcript: ENSMUST00000093944
SMART Domains Protein: ENSMUSP00000091476
Gene: ENSMUSG00000048763

DomainStartEndE-ValueType
low complexity region 76 121 N/A INTRINSIC
low complexity region 154 181 N/A INTRINSIC
HOX 191 253 5.44e-28 SMART
low complexity region 256 274 N/A INTRINSIC
Pfam:DUF4074 368 431 1.9e-37 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.4%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Intracellular or ectopic expression of this protein expands hematopoietic stem and progenitor cells in vivo and in vitro, making it a potential candidate for therapeutic stem cell expansion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene causes cervical vertebral transformation and may lead to pre- or neonatal lethality, sternal defects, impaired ventral body wall formation, diaphragm hernias and heart anomalies. Homozygotes for a null allele show a proliferation defect in hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 A T 14: 66,057,731 F222I probably damaging Het
Adam34 A T 8: 43,652,090 C173S possibly damaging Het
Ahi1 T C 10: 20,965,693 V293A probably damaging Het
AI182371 A T 2: 35,086,485 Y223N probably damaging Het
Armc4 A G 18: 7,286,688 L181P probably damaging Het
Asmt C A X: 170,675,829 F181L probably damaging Het
Axin1 T A 17: 26,187,991 H519Q probably damaging Het
Cdc5l A T 17: 45,404,706 V660E probably damaging Het
Cep152 C T 2: 125,583,889 R852H probably benign Het
Cpne4 T C 9: 104,989,579 V230A possibly damaging Het
Cttnbp2 A T 6: 18,408,657 N988K probably benign Het
D430041D05Rik A G 2: 104,221,211 I767T probably damaging Het
Dgki A G 6: 36,915,490 M851T probably benign Het
Dnah8 T C 17: 30,713,098 probably null Het
Dscaml1 A G 9: 45,672,749 E504G probably damaging Het
Dzank1 G A 2: 144,481,669 A618V probably benign Het
Fam189b A C 3: 89,188,094 Y511S probably damaging Het
Fat2 T A 11: 55,267,684 S3403C probably damaging Het
Fat2 C T 11: 55,284,719 V1723I probably benign Het
Flt1 A T 5: 147,676,430 F334I probably damaging Het
Galnt12 G T 4: 47,108,585 probably null Het
Gzmc T C 14: 56,232,280 I188V possibly damaging Het
Herc1 T C 9: 66,473,538 S3566P possibly damaging Het
Idh3b C T 2: 130,281,745 V141I probably benign Het
Kif24 A G 4: 41,393,529 S1249P probably benign Het
Leo1 T C 9: 75,466,260 Y656H possibly damaging Het
Map3k20 G A 2: 72,410,177 W339* probably null Het
Map3k5 T C 10: 20,136,911 V1259A possibly damaging Het
Masp2 A G 4: 148,614,355 D631G probably damaging Het
Mink1 T C 11: 70,608,880 S713P probably benign Het
Mpp7 A T 18: 7,350,984 V571E possibly damaging Het
Nell1 A G 7: 50,848,558 D574G possibly damaging Het
Obscn T C 11: 59,076,896 Y392C probably damaging Het
Olfml2a A T 2: 38,960,219 Y649F probably benign Het
Olfr1295 T C 2: 111,565,346 M33V probably benign Het
Olfr161 A G 16: 3,593,209 D271G probably benign Het
Prkcg A G 7: 3,323,470 D484G probably damaging Het
Rab27a T C 9: 73,075,569 probably null Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rgl1 C T 1: 152,524,772 R624H probably damaging Het
Ric8b G A 10: 84,970,748 G159D probably damaging Het
Sbno2 C A 10: 80,060,634 A880S possibly damaging Het
Scn9a A G 2: 66,488,017 S1477P probably damaging Het
Sec22a T C 16: 35,318,873 probably benign Het
Snx14 T C 9: 88,385,739 I714M probably benign Het
Snx14 T C 9: 88,407,490 probably benign Het
Sphk2 T A 7: 45,711,540 T347S probably benign Het
Spns1 C T 7: 126,371,171 probably benign Het
Susd2 A G 10: 75,637,555 V675A probably benign Het
Sytl2 A T 7: 90,395,182 D566V probably damaging Het
Tcf25 T A 8: 123,397,091 I464N possibly damaging Het
Tex261 A T 6: 83,775,022 I49N possibly damaging Het
Tjp1 A G 7: 65,302,952 F1545L possibly damaging Het
Tmem176b A G 6: 48,834,566 S216P probably damaging Het
Topaz1 C T 9: 122,780,675 probably benign Het
Tra2a C T 6: 49,250,957 probably benign Het
Ttn A G 2: 76,722,782 F22794S possibly damaging Het
Uox G A 3: 146,612,383 W93* probably null Het
Zan A T 5: 137,412,790 probably benign Het
Zfp106 G A 2: 120,533,677 R750* probably null Het
Zfp638 A T 6: 83,979,912 probably null Het
Other mutations in Hoxb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Hoxb4 APN 11 96318900 missense probably damaging 1.00
IGL02642:Hoxb4 APN 11 96320224 missense probably damaging 1.00
R0586:Hoxb4 UTSW 11 96318887 missense probably damaging 0.99
R1548:Hoxb4 UTSW 11 96318899 nonsense probably null
R1932:Hoxb4 UTSW 11 96320041 missense probably damaging 1.00
R4571:Hoxb4 UTSW 11 96319166 missense possibly damaging 0.95
R4879:Hoxb4 UTSW 11 96320188 missense probably damaging 1.00
R4930:Hoxb4 UTSW 11 96318836 missense probably damaging 1.00
R5502:Hoxb4 UTSW 11 96320231 missense probably damaging 1.00
R6082:Hoxb4 UTSW 11 96318533 unclassified probably benign
R6375:Hoxb4 UTSW 11 96320327 makesense probably null
R6823:Hoxb4 UTSW 11 96318654 unclassified probably benign
R7217:Hoxb4 UTSW 11 96319080 missense probably benign 0.02
R7256:Hoxb4 UTSW 11 96319896 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCACTACAATCGCTACCTGACGC -3'
(R):5'- CTTGTCTCCGAAGGACTTTACCCG -3'

Sequencing Primer
(F):5'- AGAATCGGCGCATGAAGT -3'
(R):5'- AAGGACTTTACCCGGCTCC -3'
Posted On2014-04-24