Mutagenetix > Incidental Mutations

Incidental Mutation 'R1634:Adam2'

173008

Institutional Source

Beutler Lab

Gene Symbol

Adam2

Ensembl Gene

ENSMUSG00000022039

Gene Name

a disintegrin and metallopeptidase domain 2

Synonyms

fertilin beta, Ftnb, Ph30-beta

MMRRC Submission

039671-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1634 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66027329-66077733 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 66057731 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 222 (F222I)

Ref Sequence

ENSEMBL: ENSMUSP00000022618 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022618]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022618
AA Change: F222I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022618
Gene: ENSMUSG00000022039
AA Change: F222I

Domain	Start	End	E-Value	Type
Pfam:Pep_M12B_propep	17	147	2.1e-26	PFAM
Pfam:Reprolysin	184	381	7.1e-73	PFAM
DISIN	398	474	1.21e-27	SMART
ACR	475	612	6.96e-62	SMART
transmembrane domain	687	709	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225667

Meta Mutation Damage Score

0.4834

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.4%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is predominantly expressed in the epididymis, where the encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Male mice lacking the encoded protein are infertile and exhibit multiple defects in reproduction. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable, females are fertile, but males have severely reduced fertility. Mutant male sperm are defective in sperm-egg membrane adhesion, sperm-egg fusion, migration from the uterus to theoviduct, and binding to the egg zona pellucida. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	A	T	8: 43,652,090	C173S	possibly damaging	Het
Ahi1	T	C	10: 20,965,693	V293A	probably damaging	Het
AI182371	A	T	2: 35,086,485	Y223N	probably damaging	Het
Armc4	A	G	18: 7,286,688	L181P	probably damaging	Het
Asmt	C	A	X: 170,675,829	F181L	probably damaging	Het
Axin1	T	A	17: 26,187,991	H519Q	probably damaging	Het
Cdc5l	A	T	17: 45,404,706	V660E	probably damaging	Het
Cep152	C	T	2: 125,583,889	R852H	probably benign	Het
Cpne4	T	C	9: 104,989,579	V230A	possibly damaging	Het
Cttnbp2	A	T	6: 18,408,657	N988K	probably benign	Het
D430041D05Rik	A	G	2: 104,221,211	I767T	probably damaging	Het
Dgki	A	G	6: 36,915,490	M851T	probably benign	Het
Dnah8	T	C	17: 30,713,098		probably null	Het
Dscaml1	A	G	9: 45,672,749	E504G	probably damaging	Het
Dzank1	G	A	2: 144,481,669	A618V	probably benign	Het
Fam189b	A	C	3: 89,188,094	Y511S	probably damaging	Het
Fat2	C	T	11: 55,284,719	V1723I	probably benign	Het
Fat2	T	A	11: 55,267,684	S3403C	probably damaging	Het
Flt1	A	T	5: 147,676,430	F334I	probably damaging	Het
Galnt12	G	T	4: 47,108,585		probably null	Het
Gzmc	T	C	14: 56,232,280	I188V	possibly damaging	Het
Herc1	T	C	9: 66,473,538	S3566P	possibly damaging	Het
Hoxb4	C	A	11: 96,320,273		probably benign	Het
Idh3b	C	T	2: 130,281,745	V141I	probably benign	Het
Kif24	A	G	4: 41,393,529	S1249P	probably benign	Het
Leo1	T	C	9: 75,466,260	Y656H	possibly damaging	Het
Map3k20	G	A	2: 72,410,177	W339*	probably null	Het
Map3k5	T	C	10: 20,136,911	V1259A	possibly damaging	Het
Masp2	A	G	4: 148,614,355	D631G	probably damaging	Het
Mink1	T	C	11: 70,608,880	S713P	probably benign	Het
Mpp7	A	T	18: 7,350,984	V571E	possibly damaging	Het
Nell1	A	G	7: 50,848,558	D574G	possibly damaging	Het
Obscn	T	C	11: 59,076,896	Y392C	probably damaging	Het
Olfml2a	A	T	2: 38,960,219	Y649F	probably benign	Het
Olfr1295	T	C	2: 111,565,346	M33V	probably benign	Het
Olfr161	A	G	16: 3,593,209	D271G	probably benign	Het
Prkcg	A	G	7: 3,323,470	D484G	probably damaging	Het
Rab27a	T	C	9: 73,075,569		probably null	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rgl1	C	T	1: 152,524,772	R624H	probably damaging	Het
Ric8b	G	A	10: 84,970,748	G159D	probably damaging	Het
Sbno2	C	A	10: 80,060,634	A880S	possibly damaging	Het
Scn9a	A	G	2: 66,488,017	S1477P	probably damaging	Het
Sec22a	T	C	16: 35,318,873		probably benign	Het
Snx14	T	C	9: 88,385,739	I714M	probably benign	Het
Snx14	T	C	9: 88,407,490		probably benign	Het
Sphk2	T	A	7: 45,711,540	T347S	probably benign	Het
Spns1	C	T	7: 126,371,171		probably benign	Het
Susd2	A	G	10: 75,637,555	V675A	probably benign	Het
Sytl2	A	T	7: 90,395,182	D566V	probably damaging	Het
Tcf25	T	A	8: 123,397,091	I464N	possibly damaging	Het
Tex261	A	T	6: 83,775,022	I49N	possibly damaging	Het
Tjp1	A	G	7: 65,302,952	F1545L	possibly damaging	Het
Tmem176b	A	G	6: 48,834,566	S216P	probably damaging	Het
Topaz1	C	T	9: 122,780,675		probably benign	Het
Tra2a	C	T	6: 49,250,957		probably benign	Het
Ttn	A	G	2: 76,722,782	F22794S	possibly damaging	Het
Uox	G	A	3: 146,612,383	W93*	probably null	Het
Zan	A	T	5: 137,412,790		probably benign	Het
Zfp106	G	A	2: 120,533,677	R750*	probably null	Het
Zfp638	A	T	6: 83,979,912		probably null	Het

Other mutations in Adam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Adam2	APN	14	66074049	critical splice donor site	probably null
IGL00980:Adam2	APN	14	66056528	nonsense	probably null
IGL01404:Adam2	APN	14	66077210	critical splice donor site	probably null
IGL01901:Adam2	APN	14	66035229	splice site	probably benign
IGL02687:Adam2	APN	14	66069190	missense	probably damaging	1.00
IGL02692:Adam2	APN	14	66074087	missense	probably damaging	1.00
IGL02695:Adam2	APN	14	66050480	missense	probably benign	0.01
IGL02798:Adam2	APN	14	66040275	missense	probably damaging	1.00
IGL03217:Adam2	APN	14	66034813	missense	possibly damaging	0.85
IGL03256:Adam2	APN	14	66053831	missense	probably benign	0.03
sacher	UTSW	14	66068558	missense	probably damaging	1.00
zuker	UTSW	14	66059912	missense	probably benign	0.14
R0092:Adam2	UTSW	14	66053887	missense	probably damaging	1.00
R0281:Adam2	UTSW	14	66037606	missense	probably benign	0.20
R0636:Adam2	UTSW	14	66034816	missense	probably benign	0.03
R0690:Adam2	UTSW	14	66057646	missense	probably damaging	1.00
R0727:Adam2	UTSW	14	66029731	missense	probably damaging	1.00
R1477:Adam2	UTSW	14	66077700	missense	possibly damaging	0.96
R1652:Adam2	UTSW	14	66077251	missense	probably benign	0.41
R1717:Adam2	UTSW	14	66068558	missense	probably damaging	1.00
R1868:Adam2	UTSW	14	66077658	missense	probably damaging	0.99
R1915:Adam2	UTSW	14	66037557	missense	possibly damaging	0.95
R3748:Adam2	UTSW	14	66059912	missense	probably benign	0.14
R3953:Adam2	UTSW	14	66057610	missense	probably damaging	1.00
R3954:Adam2	UTSW	14	66057610	missense	probably damaging	1.00
R3955:Adam2	UTSW	14	66057610	missense	probably damaging	1.00
R3956:Adam2	UTSW	14	66057610	missense	probably damaging	1.00
R3957:Adam2	UTSW	14	66057610	missense	probably damaging	1.00
R4091:Adam2	UTSW	14	66029723	missense	probably damaging	0.97
R5673:Adam2	UTSW	14	66069232	missense	probably benign	0.03
R5761:Adam2	UTSW	14	66046146	missense	probably damaging	1.00
R6187:Adam2	UTSW	14	66068619	missense	possibly damaging	0.89
R6499:Adam2	UTSW	14	66058790	missense	probably damaging	1.00
R6730:Adam2	UTSW	14	66037576	missense	possibly damaging	0.83
R6829:Adam2	UTSW	14	66027997	critical splice donor site	probably null
R7023:Adam2	UTSW	14	66043056	missense	probably benign	0.22
R7168:Adam2	UTSW	14	66058792	missense	possibly damaging	0.89
R7228:Adam2	UTSW	14	66053912	nonsense	probably null
R7293:Adam2	UTSW	14	66035185	missense	probably benign	0.29
R7604:Adam2	UTSW	14	66056541	missense	probably benign	0.17
R7765:Adam2	UTSW	14	66059896	missense	probably damaging	1.00
R8380:Adam2	UTSW	14	66037557	missense	probably benign	0.01
R8532:Adam2	UTSW	14	66056521	missense	probably damaging	1.00
X0061:Adam2	UTSW	14	66053905	missense	possibly damaging	0.66
Z1177:Adam2	UTSW	14	66056521	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAGACACGAACCTGAGGTGC -3'
(R):5'- AGGACGCTTGCTGCTGACTAAC -3'

Sequencing Primer
(F):5'- GGGGGGTCTTAATAATCCCAC -3'
(R):5'- GCTGCTGACTAACACTTTAAGC -3'

Posted On

2014-04-24