Incidental Mutation 'R1634:Adam2'
ID173008
Institutional Source Beutler Lab
Gene Symbol Adam2
Ensembl Gene ENSMUSG00000022039
Gene Namea disintegrin and metallopeptidase domain 2
Synonymsfertilin beta, Ftnb, Ph30-beta
MMRRC Submission 039671-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1634 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location66027329-66077733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66057731 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 222 (F222I)
Ref Sequence ENSEMBL: ENSMUSP00000022618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022618]
Predicted Effect probably damaging
Transcript: ENSMUST00000022618
AA Change: F222I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022618
Gene: ENSMUSG00000022039
AA Change: F222I

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 17 147 2.1e-26 PFAM
Pfam:Reprolysin 184 381 7.1e-73 PFAM
DISIN 398 474 1.21e-27 SMART
ACR 475 612 6.96e-62 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225667
Meta Mutation Damage Score 0.4834 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.4%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is predominantly expressed in the epididymis, where the encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Male mice lacking the encoded protein are infertile and exhibit multiple defects in reproduction. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable, females are fertile, but males have severely reduced fertility. Mutant male sperm are defective in sperm-egg membrane adhesion, sperm-egg fusion, migration from the uterus to theoviduct, and binding to the egg zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A T 8: 43,652,090 C173S possibly damaging Het
Ahi1 T C 10: 20,965,693 V293A probably damaging Het
AI182371 A T 2: 35,086,485 Y223N probably damaging Het
Armc4 A G 18: 7,286,688 L181P probably damaging Het
Asmt C A X: 170,675,829 F181L probably damaging Het
Axin1 T A 17: 26,187,991 H519Q probably damaging Het
Cdc5l A T 17: 45,404,706 V660E probably damaging Het
Cep152 C T 2: 125,583,889 R852H probably benign Het
Cpne4 T C 9: 104,989,579 V230A possibly damaging Het
Cttnbp2 A T 6: 18,408,657 N988K probably benign Het
D430041D05Rik A G 2: 104,221,211 I767T probably damaging Het
Dgki A G 6: 36,915,490 M851T probably benign Het
Dnah8 T C 17: 30,713,098 probably null Het
Dscaml1 A G 9: 45,672,749 E504G probably damaging Het
Dzank1 G A 2: 144,481,669 A618V probably benign Het
Fam189b A C 3: 89,188,094 Y511S probably damaging Het
Fat2 C T 11: 55,284,719 V1723I probably benign Het
Fat2 T A 11: 55,267,684 S3403C probably damaging Het
Flt1 A T 5: 147,676,430 F334I probably damaging Het
Galnt12 G T 4: 47,108,585 probably null Het
Gzmc T C 14: 56,232,280 I188V possibly damaging Het
Herc1 T C 9: 66,473,538 S3566P possibly damaging Het
Hoxb4 C A 11: 96,320,273 probably benign Het
Idh3b C T 2: 130,281,745 V141I probably benign Het
Kif24 A G 4: 41,393,529 S1249P probably benign Het
Leo1 T C 9: 75,466,260 Y656H possibly damaging Het
Map3k20 G A 2: 72,410,177 W339* probably null Het
Map3k5 T C 10: 20,136,911 V1259A possibly damaging Het
Masp2 A G 4: 148,614,355 D631G probably damaging Het
Mink1 T C 11: 70,608,880 S713P probably benign Het
Mpp7 A T 18: 7,350,984 V571E possibly damaging Het
Nell1 A G 7: 50,848,558 D574G possibly damaging Het
Obscn T C 11: 59,076,896 Y392C probably damaging Het
Olfml2a A T 2: 38,960,219 Y649F probably benign Het
Olfr1295 T C 2: 111,565,346 M33V probably benign Het
Olfr161 A G 16: 3,593,209 D271G probably benign Het
Prkcg A G 7: 3,323,470 D484G probably damaging Het
Rab27a T C 9: 73,075,569 probably null Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rgl1 C T 1: 152,524,772 R624H probably damaging Het
Ric8b G A 10: 84,970,748 G159D probably damaging Het
Sbno2 C A 10: 80,060,634 A880S possibly damaging Het
Scn9a A G 2: 66,488,017 S1477P probably damaging Het
Sec22a T C 16: 35,318,873 probably benign Het
Snx14 T C 9: 88,385,739 I714M probably benign Het
Snx14 T C 9: 88,407,490 probably benign Het
Sphk2 T A 7: 45,711,540 T347S probably benign Het
Spns1 C T 7: 126,371,171 probably benign Het
Susd2 A G 10: 75,637,555 V675A probably benign Het
Sytl2 A T 7: 90,395,182 D566V probably damaging Het
Tcf25 T A 8: 123,397,091 I464N possibly damaging Het
Tex261 A T 6: 83,775,022 I49N possibly damaging Het
Tjp1 A G 7: 65,302,952 F1545L possibly damaging Het
Tmem176b A G 6: 48,834,566 S216P probably damaging Het
Topaz1 C T 9: 122,780,675 probably benign Het
Tra2a C T 6: 49,250,957 probably benign Het
Ttn A G 2: 76,722,782 F22794S possibly damaging Het
Uox G A 3: 146,612,383 W93* probably null Het
Zan A T 5: 137,412,790 probably benign Het
Zfp106 G A 2: 120,533,677 R750* probably null Het
Zfp638 A T 6: 83,979,912 probably null Het
Other mutations in Adam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adam2 APN 14 66074049 critical splice donor site probably null
IGL00980:Adam2 APN 14 66056528 nonsense probably null
IGL01404:Adam2 APN 14 66077210 critical splice donor site probably null
IGL01901:Adam2 APN 14 66035229 splice site probably benign
IGL02687:Adam2 APN 14 66069190 missense probably damaging 1.00
IGL02692:Adam2 APN 14 66074087 missense probably damaging 1.00
IGL02695:Adam2 APN 14 66050480 missense probably benign 0.01
IGL02798:Adam2 APN 14 66040275 missense probably damaging 1.00
IGL03217:Adam2 APN 14 66034813 missense possibly damaging 0.85
IGL03256:Adam2 APN 14 66053831 missense probably benign 0.03
sacher UTSW 14 66068558 missense probably damaging 1.00
zuker UTSW 14 66059912 missense probably benign 0.14
R0092:Adam2 UTSW 14 66053887 missense probably damaging 1.00
R0281:Adam2 UTSW 14 66037606 missense probably benign 0.20
R0636:Adam2 UTSW 14 66034816 missense probably benign 0.03
R0690:Adam2 UTSW 14 66057646 missense probably damaging 1.00
R0727:Adam2 UTSW 14 66029731 missense probably damaging 1.00
R1477:Adam2 UTSW 14 66077700 missense possibly damaging 0.96
R1652:Adam2 UTSW 14 66077251 missense probably benign 0.41
R1717:Adam2 UTSW 14 66068558 missense probably damaging 1.00
R1868:Adam2 UTSW 14 66077658 missense probably damaging 0.99
R1915:Adam2 UTSW 14 66037557 missense possibly damaging 0.95
R3748:Adam2 UTSW 14 66059912 missense probably benign 0.14
R3953:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3954:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3955:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3956:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3957:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R4091:Adam2 UTSW 14 66029723 missense probably damaging 0.97
R5673:Adam2 UTSW 14 66069232 missense probably benign 0.03
R5761:Adam2 UTSW 14 66046146 missense probably damaging 1.00
R6187:Adam2 UTSW 14 66068619 missense possibly damaging 0.89
R6499:Adam2 UTSW 14 66058790 missense probably damaging 1.00
R6730:Adam2 UTSW 14 66037576 missense possibly damaging 0.83
R6829:Adam2 UTSW 14 66027997 critical splice donor site probably null
R7023:Adam2 UTSW 14 66043056 missense probably benign 0.22
R7168:Adam2 UTSW 14 66058792 missense possibly damaging 0.89
R7228:Adam2 UTSW 14 66053912 nonsense probably null
R7293:Adam2 UTSW 14 66035185 missense probably benign 0.29
R7604:Adam2 UTSW 14 66056541 missense probably benign 0.17
R7765:Adam2 UTSW 14 66059896 missense probably damaging 1.00
R8380:Adam2 UTSW 14 66037557 missense probably benign 0.01
R8532:Adam2 UTSW 14 66056521 missense probably damaging 1.00
X0061:Adam2 UTSW 14 66053905 missense possibly damaging 0.66
Z1177:Adam2 UTSW 14 66056521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGACACGAACCTGAGGTGC -3'
(R):5'- AGGACGCTTGCTGCTGACTAAC -3'

Sequencing Primer
(F):5'- GGGGGGTCTTAATAATCCCAC -3'
(R):5'- GCTGCTGACTAACACTTTAAGC -3'
Posted On2014-04-24