Mutagenetix > Incidental Mutations

Incidental Mutation 'R1634:Axin1'

173011

Institutional Source

Beutler Lab

Gene Symbol

Axin1

Ensembl Gene

ENSMUSG00000024182

Gene Name

axin 1

Synonyms

MMRRC Submission

039671-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1634 (G1)

Quality Score

202

Status

Validated

Chromosome

Chromosomal Location

26138688-26195811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 26187991 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 519 (H519Q)

Ref Sequence

ENSEMBL: ENSMUSP00000132000 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000163421] [ENSMUST00000168282]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074370
AA Change: H519Q

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182
AA Change: H519Q

Domain	Start	End	E-Value	Type
Pfam:AXIN1_TNKS_BD	13	85	7.5e-27	PFAM
RGS	93	216	3.03e-36	SMART
low complexity region	230	241	N/A	INTRINSIC
low complexity region	330	344	N/A	INTRINSIC
coiled coil region	394	432	N/A	INTRINSIC
Pfam:Axin_b-cat_bind	468	523	3.2e-13	PFAM
low complexity region	533	544	N/A	INTRINSIC
low complexity region	699	709	N/A	INTRINSIC
low complexity region	713	727	N/A	INTRINSIC
DAX	786	868	5.92e-45	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000118904
AA Change: H519Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182
AA Change: H519Q

Domain	Start	End	E-Value	Type
RGS	93	216	3.03e-36	SMART
low complexity region	230	241	N/A	INTRINSIC
low complexity region	330	344	N/A	INTRINSIC
coiled coil region	394	432	N/A	INTRINSIC
Pfam:Axin_b-cat_bind	468	502	1.2e-18	PFAM
low complexity region	533	544	N/A	INTRINSIC
low complexity region	699	709	N/A	INTRINSIC
coiled coil region	712	734	N/A	INTRINSIC
DAX	750	832	5.92e-45	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163421
AA Change: H519Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182
AA Change: H519Q

Domain	Start	End	E-Value	Type
RGS	93	216	3.03e-36	SMART
low complexity region	230	241	N/A	INTRINSIC
low complexity region	330	344	N/A	INTRINSIC
coiled coil region	394	432	N/A	INTRINSIC
Pfam:Axin_b-cat_bind	468	502	1.2e-18	PFAM
low complexity region	533	544	N/A	INTRINSIC
low complexity region	699	709	N/A	INTRINSIC
coiled coil region	712	734	N/A	INTRINSIC
DAX	750	832	5.92e-45	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168282

SMART Domains

Protein: ENSMUSP00000127182
Gene: ENSMUSG00000024182

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
coiled coil region	126	154	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169268

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.4%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutant homozygotes die at embryonic day 8-10, exhibiting neuroectodermal defects and axial duplications. Heterozygotes exhibit skeletal, cardiac, and neurological defects including short, bent tails, and deafness with circling behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam2	A	T	14: 66,057,731	F222I	probably damaging	Het
Adam34	A	T	8: 43,652,090	C173S	possibly damaging	Het
Ahi1	T	C	10: 20,965,693	V293A	probably damaging	Het
AI182371	A	T	2: 35,086,485	Y223N	probably damaging	Het
Armc4	A	G	18: 7,286,688	L181P	probably damaging	Het
Asmt	C	A	X: 170,675,829	F181L	probably damaging	Het
Cdc5l	A	T	17: 45,404,706	V660E	probably damaging	Het
Cep152	C	T	2: 125,583,889	R852H	probably benign	Het
Cpne4	T	C	9: 104,989,579	V230A	possibly damaging	Het
Cttnbp2	A	T	6: 18,408,657	N988K	probably benign	Het
D430041D05Rik	A	G	2: 104,221,211	I767T	probably damaging	Het
Dgki	A	G	6: 36,915,490	M851T	probably benign	Het
Dnah8	T	C	17: 30,713,098		probably null	Het
Dscaml1	A	G	9: 45,672,749	E504G	probably damaging	Het
Dzank1	G	A	2: 144,481,669	A618V	probably benign	Het
Fam189b	A	C	3: 89,188,094	Y511S	probably damaging	Het
Fat2	T	A	11: 55,267,684	S3403C	probably damaging	Het
Fat2	C	T	11: 55,284,719	V1723I	probably benign	Het
Flt1	A	T	5: 147,676,430	F334I	probably damaging	Het
Galnt12	G	T	4: 47,108,585		probably null	Het
Gzmc	T	C	14: 56,232,280	I188V	possibly damaging	Het
Herc1	T	C	9: 66,473,538	S3566P	possibly damaging	Het
Hoxb4	C	A	11: 96,320,273		probably benign	Het
Idh3b	C	T	2: 130,281,745	V141I	probably benign	Het
Kif24	A	G	4: 41,393,529	S1249P	probably benign	Het
Leo1	T	C	9: 75,466,260	Y656H	possibly damaging	Het
Map3k20	G	A	2: 72,410,177	W339*	probably null	Het
Map3k5	T	C	10: 20,136,911	V1259A	possibly damaging	Het
Masp2	A	G	4: 148,614,355	D631G	probably damaging	Het
Mink1	T	C	11: 70,608,880	S713P	probably benign	Het
Mpp7	A	T	18: 7,350,984	V571E	possibly damaging	Het
Nell1	A	G	7: 50,848,558	D574G	possibly damaging	Het
Obscn	T	C	11: 59,076,896	Y392C	probably damaging	Het
Olfml2a	A	T	2: 38,960,219	Y649F	probably benign	Het
Olfr1295	T	C	2: 111,565,346	M33V	probably benign	Het
Olfr161	A	G	16: 3,593,209	D271G	probably benign	Het
Prkcg	A	G	7: 3,323,470	D484G	probably damaging	Het
Rab27a	T	C	9: 73,075,569		probably null	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rgl1	C	T	1: 152,524,772	R624H	probably damaging	Het
Ric8b	G	A	10: 84,970,748	G159D	probably damaging	Het
Sbno2	C	A	10: 80,060,634	A880S	possibly damaging	Het
Scn9a	A	G	2: 66,488,017	S1477P	probably damaging	Het
Sec22a	T	C	16: 35,318,873		probably benign	Het
Snx14	T	C	9: 88,385,739	I714M	probably benign	Het
Snx14	T	C	9: 88,407,490		probably benign	Het
Sphk2	T	A	7: 45,711,540	T347S	probably benign	Het
Spns1	C	T	7: 126,371,171		probably benign	Het
Susd2	A	G	10: 75,637,555	V675A	probably benign	Het
Sytl2	A	T	7: 90,395,182	D566V	probably damaging	Het
Tcf25	T	A	8: 123,397,091	I464N	possibly damaging	Het
Tex261	A	T	6: 83,775,022	I49N	possibly damaging	Het
Tjp1	A	G	7: 65,302,952	F1545L	possibly damaging	Het
Tmem176b	A	G	6: 48,834,566	S216P	probably damaging	Het
Topaz1	C	T	9: 122,780,675		probably benign	Het
Tra2a	C	T	6: 49,250,957		probably benign	Het
Ttn	A	G	2: 76,722,782	F22794S	possibly damaging	Het
Uox	G	A	3: 146,612,383	W93*	probably null	Het
Zan	A	T	5: 137,412,790		probably benign	Het
Zfp106	G	A	2: 120,533,677	R750*	probably null	Het
Zfp638	A	T	6: 83,979,912		probably null	Het

Other mutations in Axin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Axin1	APN	17	26142805	missense	possibly damaging	0.88
IGL00229:Axin1	APN	17	26194072	missense	probably damaging	1.00
IGL01141:Axin1	APN	17	26190041	missense	probably damaging	0.98
IGL02088:Axin1	APN	17	26188695	missense	probably benign	0.05
IGL02413:Axin1	APN	17	26188179	missense	probably benign	0.00
Salvation	UTSW	17	26143240	missense	probably damaging	0.98
R0331:Axin1	UTSW	17	26143107	missense	probably damaging	1.00
R0454:Axin1	UTSW	17	26173663	missense	probably benign	0.00
R0538:Axin1	UTSW	17	26184241	missense	possibly damaging	0.66
R0755:Axin1	UTSW	17	26182506	missense	possibly damaging	0.95
R0976:Axin1	UTSW	17	26188086	missense	probably damaging	1.00
R1950:Axin1	UTSW	17	26193964	missense	possibly damaging	0.62
R1965:Axin1	UTSW	17	26184225	missense	probably damaging	1.00
R1965:Axin1	UTSW	17	26190228	missense	probably damaging	0.97
R2180:Axin1	UTSW	17	26143335	missense	probably benign
R3051:Axin1	UTSW	17	26190125	missense	probably benign	0.01
R3413:Axin1	UTSW	17	26188038	missense	probably damaging	0.99
R3849:Axin1	UTSW	17	26187797	missense	probably benign	0.01
R4530:Axin1	UTSW	17	26188172	missense	probably benign	0.09
R4560:Axin1	UTSW	17	26173771	missense	probably damaging	1.00
R4764:Axin1	UTSW	17	26173756	missense	possibly damaging	0.46
R4976:Axin1	UTSW	17	26194070	missense	probably benign	0.42
R4976:Axin1	UTSW	17	26194071	missense	probably benign	0.24
R5299:Axin1	UTSW	17	26173734	missense	probably damaging	0.99
R5682:Axin1	UTSW	17	26187801	missense	probably benign
R5690:Axin1	UTSW	17	26194937	missense	probably damaging	1.00
R5722:Axin1	UTSW	17	26182557	missense	probably damaging	1.00
R5793:Axin1	UTSW	17	26143308	missense	probably damaging	1.00
R6108:Axin1	UTSW	17	26143240	missense	probably damaging	0.98
R6282:Axin1	UTSW	17	26143037	missense	probably damaging	1.00
R6490:Axin1	UTSW	17	26142994	missense	probably damaging	1.00
R7153:Axin1	UTSW	17	26187968	missense	probably benign
R7181:Axin1	UTSW	17	26173778	missense	probably damaging	1.00
R7456:Axin1	UTSW	17	26143165	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGGAGAATCCTGAGAGCATCCTG -3'
(R):5'- GGCTGGATCAAGACTCACCCAAAG -3'

Sequencing Primer
(F):5'- CCTGAGAGCATCCTGGATGAG -3'
(R):5'- TGCGTTCTCGGAATAGCTC -3'

Posted On

2014-04-24