Mutagenetix > Incidental Mutations

Incidental Mutation 'R1634:Armc4'

173014

Institutional Source

Beutler Lab

Gene Symbol

Armc4

Ensembl Gene

ENSMUSG00000061802

Gene Name

armadillo repeat containing 4

Synonyms

b2b643Clo, 4930463I21Rik, b2b227.1Clo

MMRRC Submission

039671-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R1634 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7088233-7297901 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7286688 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 181 (L181P)

Ref Sequence

ENSEMBL: ENSMUSP00000080028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081275]

Predicted Effect

probably damaging
Transcript: ENSMUST00000081275
AA Change: L181P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802
AA Change: L181P

Domain	Start	End	E-Value	Type
low complexity region	172	186	N/A	INTRINSIC
low complexity region	410	428	N/A	INTRINSIC
ARM	475	516	1.38e1	SMART
ARM	517	557	2.38e-2	SMART
ARM	558	613	3.97e0	SMART
ARM	614	654	2.59e-3	SMART
ARM	655	695	3.48e1	SMART
ARM	696	737	1.6e1	SMART
ARM	738	778	4.09e0	SMART
ARM	779	819	9.68e0	SMART
ARM	861	903	3.52e0	SMART
ARM	904	944	1.26e1	SMART
ARM	945	985	1.03e1	SMART
ARM	986	1026	1.13e-3	SMART

Meta Mutation Damage Score

0.2980

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.4%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam2	A	T	14: 66,057,731	F222I	probably damaging	Het
Adam34	A	T	8: 43,652,090	C173S	possibly damaging	Het
Ahi1	T	C	10: 20,965,693	V293A	probably damaging	Het
AI182371	A	T	2: 35,086,485	Y223N	probably damaging	Het
Asmt	C	A	X: 170,675,829	F181L	probably damaging	Het
Axin1	T	A	17: 26,187,991	H519Q	probably damaging	Het
Cdc5l	A	T	17: 45,404,706	V660E	probably damaging	Het
Cep152	C	T	2: 125,583,889	R852H	probably benign	Het
Cpne4	T	C	9: 104,989,579	V230A	possibly damaging	Het
Cttnbp2	A	T	6: 18,408,657	N988K	probably benign	Het
D430041D05Rik	A	G	2: 104,221,211	I767T	probably damaging	Het
Dgki	A	G	6: 36,915,490	M851T	probably benign	Het
Dnah8	T	C	17: 30,713,098		probably null	Het
Dscaml1	A	G	9: 45,672,749	E504G	probably damaging	Het
Dzank1	G	A	2: 144,481,669	A618V	probably benign	Het
Fam189b	A	C	3: 89,188,094	Y511S	probably damaging	Het
Fat2	T	A	11: 55,267,684	S3403C	probably damaging	Het
Fat2	C	T	11: 55,284,719	V1723I	probably benign	Het
Flt1	A	T	5: 147,676,430	F334I	probably damaging	Het
Galnt12	G	T	4: 47,108,585		probably null	Het
Gzmc	T	C	14: 56,232,280	I188V	possibly damaging	Het
Herc1	T	C	9: 66,473,538	S3566P	possibly damaging	Het
Hoxb4	C	A	11: 96,320,273		probably benign	Het
Idh3b	C	T	2: 130,281,745	V141I	probably benign	Het
Kif24	A	G	4: 41,393,529	S1249P	probably benign	Het
Leo1	T	C	9: 75,466,260	Y656H	possibly damaging	Het
Map3k20	G	A	2: 72,410,177	W339*	probably null	Het
Map3k5	T	C	10: 20,136,911	V1259A	possibly damaging	Het
Masp2	A	G	4: 148,614,355	D631G	probably damaging	Het
Mink1	T	C	11: 70,608,880	S713P	probably benign	Het
Mpp7	A	T	18: 7,350,984	V571E	possibly damaging	Het
Nell1	A	G	7: 50,848,558	D574G	possibly damaging	Het
Obscn	T	C	11: 59,076,896	Y392C	probably damaging	Het
Olfml2a	A	T	2: 38,960,219	Y649F	probably benign	Het
Olfr1295	T	C	2: 111,565,346	M33V	probably benign	Het
Olfr161	A	G	16: 3,593,209	D271G	probably benign	Het
Prkcg	A	G	7: 3,323,470	D484G	probably damaging	Het
Rab27a	T	C	9: 73,075,569		probably null	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rgl1	C	T	1: 152,524,772	R624H	probably damaging	Het
Ric8b	G	A	10: 84,970,748	G159D	probably damaging	Het
Sbno2	C	A	10: 80,060,634	A880S	possibly damaging	Het
Scn9a	A	G	2: 66,488,017	S1477P	probably damaging	Het
Sec22a	T	C	16: 35,318,873		probably benign	Het
Snx14	T	C	9: 88,385,739	I714M	probably benign	Het
Snx14	T	C	9: 88,407,490		probably benign	Het
Sphk2	T	A	7: 45,711,540	T347S	probably benign	Het
Spns1	C	T	7: 126,371,171		probably benign	Het
Susd2	A	G	10: 75,637,555	V675A	probably benign	Het
Sytl2	A	T	7: 90,395,182	D566V	probably damaging	Het
Tcf25	T	A	8: 123,397,091	I464N	possibly damaging	Het
Tex261	A	T	6: 83,775,022	I49N	possibly damaging	Het
Tjp1	A	G	7: 65,302,952	F1545L	possibly damaging	Het
Tmem176b	A	G	6: 48,834,566	S216P	probably damaging	Het
Topaz1	C	T	9: 122,780,675		probably benign	Het
Tra2a	C	T	6: 49,250,957		probably benign	Het
Ttn	A	G	2: 76,722,782	F22794S	possibly damaging	Het
Uox	G	A	3: 146,612,383	W93*	probably null	Het
Zan	A	T	5: 137,412,790		probably benign	Het
Zfp106	G	A	2: 120,533,677	R750*	probably null	Het
Zfp638	A	T	6: 83,979,912		probably null	Het

Other mutations in Armc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Armc4	APN	18	7211504	missense	probably damaging	0.96
IGL00822:Armc4	APN	18	7181817	missense	probably damaging	1.00
IGL01345:Armc4	APN	18	7266947	missense	probably benign	0.00
IGL01593:Armc4	APN	18	7127345	missense	probably benign	0.00
IGL01645:Armc4	APN	18	7268491	missense	probably benign	0.00
IGL01863:Armc4	APN	18	7222617	missense	probably damaging	1.00
IGL01955:Armc4	APN	18	7127291	missense	possibly damaging	0.89
IGL02013:Armc4	APN	18	7265157	splice site	probably benign
IGL02142:Armc4	APN	18	7214601	missense	probably damaging	1.00
IGL02399:Armc4	APN	18	7285719	missense	probably benign
IGL02439:Armc4	APN	18	7268444	missense	probably benign	0.04
IGL02452:Armc4	APN	18	7129461	missense	probably damaging	1.00
IGL02632:Armc4	APN	18	7214727	splice site	probably benign
IGL03344:Armc4	APN	18	7129434	nonsense	probably null
R0062:Armc4	UTSW	18	7129593	splice site	probably benign
R0062:Armc4	UTSW	18	7129593	splice site	probably benign
R0242:Armc4	UTSW	18	7211516	missense	probably damaging	0.96
R0242:Armc4	UTSW	18	7211516	missense	probably damaging	0.96
R0365:Armc4	UTSW	18	7217800	missense	probably benign	0.01
R0377:Armc4	UTSW	18	7127415	missense	probably benign	0.04
R0466:Armc4	UTSW	18	7286758	missense	probably benign	0.10
R0517:Armc4	UTSW	18	7223621	missense	probably damaging	1.00
R0521:Armc4	UTSW	18	7222676	missense	possibly damaging	0.64
R0841:Armc4	UTSW	18	7268436	missense	probably damaging	0.99
R1145:Armc4	UTSW	18	7268436	missense	probably damaging	0.99
R1145:Armc4	UTSW	18	7268436	missense	probably damaging	0.99
R1435:Armc4	UTSW	18	7222646	missense	probably benign	0.01
R1487:Armc4	UTSW	18	7273245	missense	probably damaging	0.98
R1677:Armc4	UTSW	18	7222554	missense	probably benign	0.01
R1778:Armc4	UTSW	18	7127388	missense	probably damaging	1.00
R1792:Armc4	UTSW	18	7286743	missense	probably benign	0.00
R1809:Armc4	UTSW	18	7211630	missense	probably benign	0.08
R1842:Armc4	UTSW	18	7223551	missense	probably benign	0.04
R2144:Armc4	UTSW	18	7127229	missense	probably damaging	0.96
R2206:Armc4	UTSW	18	7223676	missense	probably benign	0.25
R2273:Armc4	UTSW	18	7223676	missense	probably benign	0.25
R2275:Armc4	UTSW	18	7223676	missense	probably benign	0.25
R2918:Armc4	UTSW	18	7222625	missense	probably benign	0.04
R3421:Armc4	UTSW	18	7223523	splice site	probably benign
R3422:Armc4	UTSW	18	7223523	splice site	probably benign
R4165:Armc4	UTSW	18	7217008	missense	probably damaging	1.00
R4225:Armc4	UTSW	18	7181732	critical splice donor site	probably null
R4660:Armc4	UTSW	18	7211609	missense	possibly damaging	0.88
R4745:Armc4	UTSW	18	7286763	missense	probably benign	0.28
R4812:Armc4	UTSW	18	7288634	missense	possibly damaging	0.79
R4831:Armc4	UTSW	18	7222564	missense	possibly damaging	0.79
R4923:Armc4	UTSW	18	7181787	missense	probably damaging	0.97
R4995:Armc4	UTSW	18	7223663	missense	probably damaging	1.00
R5024:Armc4	UTSW	18	7088555	missense	probably benign	0.02
R5335:Armc4	UTSW	18	7294566	missense	probably benign	0.06
R5434:Armc4	UTSW	18	7222550	missense	probably benign	0.03
R5552:Armc4	UTSW	18	7285360	missense	possibly damaging	0.51
R5719:Armc4	UTSW	18	7211496	missense	probably benign	0.00
R5736:Armc4	UTSW	18	7268416	missense	probably benign	0.01
R5792:Armc4	UTSW	18	7217965	missense	probably benign	0.00
R5848:Armc4	UTSW	18	7268507	synonymous	probably null
R5957:Armc4	UTSW	18	7285706	missense	probably benign	0.01
R6001:Armc4	UTSW	18	7286838	missense	probably benign	0.03
R6309:Armc4	UTSW	18	7214617	missense	probably benign	0.04
R6559:Armc4	UTSW	18	7223664	missense	probably damaging	0.99
R6574:Armc4	UTSW	18	7129394	splice site	probably null
R6581:Armc4	UTSW	18	7129560	missense	possibly damaging	0.77
R6736:Armc4	UTSW	18	7223586	missense	probably damaging	0.98
R6842:Armc4	UTSW	18	7268401	missense	probably benign	0.00
R6968:Armc4	UTSW	18	7273155	splice site	probably null
R6974:Armc4	UTSW	18	7294479	missense	probably benign	0.37
R7024:Armc4	UTSW	18	7211593	missense	probably benign	0.43
R7299:Armc4	UTSW	18	7222635	missense	probably damaging	1.00
R7578:Armc4	UTSW	18	7211593	missense	probably benign	0.43
R7737:Armc4	UTSW	18	7217890	missense	probably damaging	1.00
Z1088:Armc4	UTSW	18	7266919	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCTTCTGACCTGGAGAAAACCC -3'
(R):5'- GGCTTGTCCAAAGGAAGCTGACTG -3'

Sequencing Primer
(F):5'- GAGAAAACCCCCATTAGACTGTTAG -3'
(R):5'- TGTCTTTGTTGCACTGGATAATC -3'

Posted On

2014-04-24