Incidental Mutation 'R1635:Ankar'
ID 173020
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R1635 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 72642980-72700579 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72650138 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1278 (Y1278C)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
AlphaFold A2RT91
Predicted Effect probably damaging
Transcript: ENSMUST00000053499
AA Change: Y1278C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: Y1278C

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211837
AA Change: Y1277C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212573
AA Change: Y1060C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A T 2: 25,444,856 I1947F probably benign Het
Adgrd1 G T 5: 129,128,907 V182F probably damaging Het
Agmat A G 4: 141,747,069 D87G probably damaging Het
AI182371 T C 2: 35,088,737 probably null Het
Anapc1 G T 2: 128,628,532 H1559Q probably damaging Het
Arhgef2 A T 3: 88,639,321 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Banp A T 8: 122,001,011 I130F probably damaging Het
C130050O18Rik G T 5: 139,414,493 R100S probably benign Het
Carmil3 A G 14: 55,496,282 T374A possibly damaging Het
Cc2d2a T A 5: 43,722,470 W1076R probably damaging Het
Cdc34 T G 10: 79,688,054 S235A probably benign Het
Cdh8 G T 8: 99,031,024 H647Q probably damaging Het
Cdk1 A T 10: 69,338,547 L282Q probably damaging Het
Ceacam3 A G 7: 17,159,977 D471G probably damaging Het
Cltc A T 11: 86,757,279 I4N probably benign Het
Cntfr T A 4: 41,658,816 E305V probably damaging Het
Cwh43 T A 5: 73,434,310 I496N probably damaging Het
Cyp2f2 A G 7: 27,129,724 N218S probably benign Het
D16Ertd472e A G 16: 78,546,504 probably null Het
Dab2 A G 15: 6,429,870 Q400R possibly damaging Het
Dapl1 A T 2: 59,496,562 I51F probably benign Het
Drc7 G A 8: 95,074,332 probably null Het
Etl4 A G 2: 20,806,408 T1101A probably damaging Het
Fam83c C A 2: 155,830,051 R488M possibly damaging Het
Fam96b A T 8: 104,640,988 I108N possibly damaging Het
Fbxo42 A G 4: 141,200,529 T707A probably damaging Het
Fcmr A T 1: 130,876,185 probably null Het
Fer1l6 G C 15: 58,647,081 K1687N probably damaging Het
Fgd4 G A 16: 16,475,029 R275* probably null Het
Fxr2 G A 11: 69,641,313 C87Y possibly damaging Het
Gja4 A T 4: 127,312,679 I97N probably damaging Het
Gm136 A G 4: 34,750,919 probably null Het
Gm14496 A G 2: 182,001,044 D836G possibly damaging Het
Gm8882 A G 6: 132,363,006 probably null Het
Grm3 T A 5: 9,511,520 T777S probably damaging Het
Guca2b A G 4: 119,657,715 Y50H probably damaging Het
Herc2 C T 7: 56,136,667 P1587S probably benign Het
Hmcn1 C T 1: 150,669,558 S2766N probably benign Het
Idi2 T A 13: 8,959,419 I224K probably damaging Het
Kmt2a A T 9: 44,824,369 probably benign Het
Lonp2 A T 8: 86,713,450 M693L possibly damaging Het
Megf8 G T 7: 25,346,747 M1525I possibly damaging Het
Mgme1 T C 2: 144,279,098 V276A possibly damaging Het
Mief2 G T 11: 60,731,408 W268L probably damaging Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mreg T C 1: 72,192,197 N34S probably benign Het
Myf6 T C 10: 107,494,673 Y11C probably damaging Het
Myh9 C A 15: 77,771,167 Q1196H probably benign Het
Myh9 A T 15: 77,775,899 D56E probably benign Het
Myo5c A T 9: 75,277,075 R949S probably benign Het
Ncapg2 TAA TA 12: 116,434,685 probably null Het
Nfx1 T A 4: 40,977,004 V226E probably benign Het
Nlrp10 T A 7: 108,924,530 K581M possibly damaging Het
Nmd3 T G 3: 69,739,984 I273S probably benign Het
Olfr1264 A T 2: 90,021,970 I32N possibly damaging Het
P4hb T C 11: 120,571,616 E88G probably damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pdia4 A T 6: 47,799,199 F421L possibly damaging Het
Picalm T A 7: 90,191,251 S538T probably damaging Het
Ppp2r2b T A 18: 43,059,210 I11F probably benign Het
Ptk7 C T 17: 46,573,534 E757K possibly damaging Het
Rbm22 T G 18: 60,561,268 C24W probably damaging Het
Rev3l A G 10: 39,806,662 D288G probably damaging Het
Rgs18 T A 1: 144,754,053 H156L probably benign Het
Rnf213 A G 11: 119,442,579 I2871M probably damaging Het
Rrm2b A T 15: 37,945,084 M137K probably damaging Het
Rrp12 A T 19: 41,868,785 D1183E probably benign Het
Sacs G A 14: 61,203,828 V1108M probably damaging Het
Scube2 A T 7: 109,843,214 D270E possibly damaging Het
Serpina3a T A 12: 104,116,478 F170Y probably damaging Het
Serpinb3b T C 1: 107,154,673 E287G probably benign Het
Slamf8 C T 1: 172,584,619 V130M probably damaging Het
Slc5a3 T C 16: 92,077,396 S114P possibly damaging Het
Sos1 T A 17: 80,422,679 probably null Het
Sox10 A T 15: 79,156,460 D293E probably damaging Het
Sphk1 A G 11: 116,535,770 D177G probably damaging Het
Sphkap T G 1: 83,278,400 M543L probably benign Het
Syt13 A T 2: 92,953,415 K343N probably damaging Het
Tatdn3 A G 1: 191,060,176 M34T probably benign Het
Timd4 T G 11: 46,842,162 V305G possibly damaging Het
Tnnc2 T C 2: 164,777,592 I111V probably benign Het
Togaram2 C T 17: 71,697,851 P301L probably benign Het
Trpc3 T C 3: 36,640,627 N726S probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ugt1a5 T A 1: 88,166,083 probably benign Het
Ulk3 A T 9: 57,593,160 probably null Het
Unc5d T A 8: 28,760,749 I297L probably benign Het
Usp20 A G 2: 31,018,818 I804V probably benign Het
Usp22 G T 11: 61,161,318 C278* probably null Het
Usp53 A T 3: 122,934,223 N903K probably benign Het
V1rd19 T C 7: 24,003,387 F93L probably benign Het
Zdbf2 T A 1: 63,304,334 V624E possibly damaging Het
Zfyve16 A T 13: 92,509,020 S1073T probably damaging Het
Zkscan8 T C 13: 21,526,595 H115R possibly damaging Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8008:Ankar UTSW 1 72666484 missense possibly damaging 0.47
R8119:Ankar UTSW 1 72647001 missense probably damaging 0.98
R8244:Ankar UTSW 1 72651024 missense probably benign
R8342:Ankar UTSW 1 72652460 missense probably damaging 1.00
R8494:Ankar UTSW 1 72658794 missense probably benign 0.16
R8851:Ankar UTSW 1 72652376 missense probably damaging 1.00
R8970:Ankar UTSW 1 72652337 critical splice donor site probably null
R9228:Ankar UTSW 1 72674051 missense probably benign 0.27
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAGCACTTTCCGTTTTACAAATAGCC -3'
(R):5'- TGCACTGACCATTGTGTCTCAAGAAG -3'

Sequencing Primer
(F):5'- CCGTTTTACAAATAGCCTtttctttc -3'
(R):5'- TGTCTCAAGAAGTAGACATGGTGC -3'
Posted On 2014-04-24