Incidental Mutation 'R1635:Gm14496'
ID173043
Institutional Source Beutler Lab
Gene Symbol Gm14496
Ensembl Gene ENSMUSG00000098505
Gene Namepredicted gene 14496
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1635 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181991226-182001766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 182001044 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 836 (D836G)
Ref Sequence ENSEMBL: ENSMUSP00000071670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071760]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071760
AA Change: D836G

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071670
Gene: ENSMUSG00000098505
AA Change: D836G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 456 1.3e-30 PFAM
Pfam:NCD3G 508 562 1.9e-18 PFAM
Pfam:7tm_3 595 830 7.9e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089788
SMART Domains Protein: ENSMUSP00000087221
Gene: ENSMUSG00000053277

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 425 2.8e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184507
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A T 2: 25,444,856 I1947F probably benign Het
Adgrd1 G T 5: 129,128,907 V182F probably damaging Het
Agmat A G 4: 141,747,069 D87G probably damaging Het
AI182371 T C 2: 35,088,737 probably null Het
Anapc1 G T 2: 128,628,532 H1559Q probably damaging Het
Ankar T C 1: 72,650,138 Y1278C probably damaging Het
Arhgef2 A T 3: 88,639,321 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Banp A T 8: 122,001,011 I130F probably damaging Het
C130050O18Rik G T 5: 139,414,493 R100S probably benign Het
Carmil3 A G 14: 55,496,282 T374A possibly damaging Het
Cc2d2a T A 5: 43,722,470 W1076R probably damaging Het
Cdc34 T G 10: 79,688,054 S235A probably benign Het
Cdh8 G T 8: 99,031,024 H647Q probably damaging Het
Cdk1 A T 10: 69,338,547 L282Q probably damaging Het
Ceacam3 A G 7: 17,159,977 D471G probably damaging Het
Cltc A T 11: 86,757,279 I4N probably benign Het
Cntfr T A 4: 41,658,816 E305V probably damaging Het
Cwh43 T A 5: 73,434,310 I496N probably damaging Het
Cyp2f2 A G 7: 27,129,724 N218S probably benign Het
D16Ertd472e A G 16: 78,546,504 probably null Het
Dab2 A G 15: 6,429,870 Q400R possibly damaging Het
Dapl1 A T 2: 59,496,562 I51F probably benign Het
Drc7 G A 8: 95,074,332 probably null Het
Etl4 A G 2: 20,806,408 T1101A probably damaging Het
Fam83c C A 2: 155,830,051 R488M possibly damaging Het
Fam96b A T 8: 104,640,988 I108N possibly damaging Het
Fbxo42 A G 4: 141,200,529 T707A probably damaging Het
Fcmr A T 1: 130,876,185 probably null Het
Fer1l6 G C 15: 58,647,081 K1687N probably damaging Het
Fgd4 G A 16: 16,475,029 R275* probably null Het
Fxr2 G A 11: 69,641,313 C87Y possibly damaging Het
Gja4 A T 4: 127,312,679 I97N probably damaging Het
Gm136 A G 4: 34,750,919 probably null Het
Gm8882 A G 6: 132,363,006 probably null Het
Grm3 T A 5: 9,511,520 T777S probably damaging Het
Guca2b A G 4: 119,657,715 Y50H probably damaging Het
Herc2 C T 7: 56,136,667 P1587S probably benign Het
Hmcn1 C T 1: 150,669,558 S2766N probably benign Het
Idi2 T A 13: 8,959,419 I224K probably damaging Het
Kmt2a A T 9: 44,824,369 probably benign Het
Lonp2 A T 8: 86,713,450 M693L possibly damaging Het
Megf8 G T 7: 25,346,747 M1525I possibly damaging Het
Mgme1 T C 2: 144,279,098 V276A possibly damaging Het
Mief2 G T 11: 60,731,408 W268L probably damaging Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mreg T C 1: 72,192,197 N34S probably benign Het
Myf6 T C 10: 107,494,673 Y11C probably damaging Het
Myh9 C A 15: 77,771,167 Q1196H probably benign Het
Myh9 A T 15: 77,775,899 D56E probably benign Het
Myo5c A T 9: 75,277,075 R949S probably benign Het
Ncapg2 TAA TA 12: 116,434,685 probably null Het
Nfx1 T A 4: 40,977,004 V226E probably benign Het
Nlrp10 T A 7: 108,924,530 K581M possibly damaging Het
Nmd3 T G 3: 69,739,984 I273S probably benign Het
Olfr1264 A T 2: 90,021,970 I32N possibly damaging Het
P4hb T C 11: 120,571,616 E88G probably damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pdia4 A T 6: 47,799,199 F421L possibly damaging Het
Picalm T A 7: 90,191,251 S538T probably damaging Het
Ppp2r2b T A 18: 43,059,210 I11F probably benign Het
Ptk7 C T 17: 46,573,534 E757K possibly damaging Het
Rbm22 T G 18: 60,561,268 C24W probably damaging Het
Rev3l A G 10: 39,806,662 D288G probably damaging Het
Rgs18 T A 1: 144,754,053 H156L probably benign Het
Rnf213 A G 11: 119,442,579 I2871M probably damaging Het
Rrm2b A T 15: 37,945,084 M137K probably damaging Het
Rrp12 A T 19: 41,868,785 D1183E probably benign Het
Sacs G A 14: 61,203,828 V1108M probably damaging Het
Scube2 A T 7: 109,843,214 D270E possibly damaging Het
Serpina3a T A 12: 104,116,478 F170Y probably damaging Het
Serpinb3b T C 1: 107,154,673 E287G probably benign Het
Slamf8 C T 1: 172,584,619 V130M probably damaging Het
Slc5a3 T C 16: 92,077,396 S114P possibly damaging Het
Sos1 T A 17: 80,422,679 probably null Het
Sox10 A T 15: 79,156,460 D293E probably damaging Het
Sphk1 A G 11: 116,535,770 D177G probably damaging Het
Sphkap T G 1: 83,278,400 M543L probably benign Het
Syt13 A T 2: 92,953,415 K343N probably damaging Het
Tatdn3 A G 1: 191,060,176 M34T probably benign Het
Timd4 T G 11: 46,842,162 V305G possibly damaging Het
Tnnc2 T C 2: 164,777,592 I111V probably benign Het
Togaram2 C T 17: 71,697,851 P301L probably benign Het
Trpc3 T C 3: 36,640,627 N726S probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ugt1a5 T A 1: 88,166,083 probably benign Het
Ulk3 A T 9: 57,593,160 probably null Het
Unc5d T A 8: 28,760,749 I297L probably benign Het
Usp20 A G 2: 31,018,818 I804V probably benign Het
Usp22 G T 11: 61,161,318 C278* probably null Het
Usp53 A T 3: 122,934,223 N903K probably benign Het
V1rd19 T C 7: 24,003,387 F93L probably benign Het
Zdbf2 T A 1: 63,304,334 V624E possibly damaging Het
Zfyve16 A T 13: 92,509,020 S1073T probably damaging Het
Zkscan8 T C 13: 21,526,595 H115R possibly damaging Het
Other mutations in Gm14496
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Gm14496 APN 2 181995021 missense probably damaging 1.00
IGL01300:Gm14496 APN 2 182000960 missense probably damaging 1.00
IGL01328:Gm14496 APN 2 181995880 missense probably damaging 1.00
IGL01526:Gm14496 APN 2 181995665 missense probably benign 0.12
IGL01576:Gm14496 APN 2 181991371 missense possibly damaging 0.92
IGL01775:Gm14496 APN 2 182000332 missense probably benign 0.00
IGL02020:Gm14496 APN 2 181996089 missense possibly damaging 0.95
IGL02150:Gm14496 APN 2 181991347 missense probably damaging 0.99
IGL02170:Gm14496 APN 2 181996351 missense probably damaging 1.00
IGL02262:Gm14496 APN 2 181996012 missense probably damaging 1.00
IGL02398:Gm14496 APN 2 181996170 missense probably benign 0.09
IGL02414:Gm14496 APN 2 181991405 missense probably benign 0.03
IGL02541:Gm14496 APN 2 182000393 missense probably benign 0.29
IGL02741:Gm14496 APN 2 181991343 missense probably benign
IGL02933:Gm14496 APN 2 182000463 missense probably benign 0.15
IGL03214:Gm14496 APN 2 182000536 missense probably damaging 1.00
FR4342:Gm14496 UTSW 2 181995906 missense probably benign 0.01
R0158:Gm14496 UTSW 2 181997413 missense probably benign 0.07
R0271:Gm14496 UTSW 2 181995954 missense probably benign 0.44
R0611:Gm14496 UTSW 2 181995111 missense probably benign 0.00
R0833:Gm14496 UTSW 2 181996266 missense probably damaging 0.99
R0834:Gm14496 UTSW 2 181995687 missense probably benign 0.00
R0906:Gm14496 UTSW 2 182000515 missense probably damaging 0.98
R1298:Gm14496 UTSW 2 181996092 missense probably benign 0.39
R1500:Gm14496 UTSW 2 181991233 missense probably benign 0.21
R1585:Gm14496 UTSW 2 181996209 missense possibly damaging 0.79
R1610:Gm14496 UTSW 2 181996179 missense probably benign 0.01
R1627:Gm14496 UTSW 2 181998778 missense probably damaging 1.00
R1663:Gm14496 UTSW 2 181997437 missense probably benign 0.03
R1792:Gm14496 UTSW 2 181996153 missense probably benign 0.00
R1888:Gm14496 UTSW 2 182000196 nonsense probably null
R1888:Gm14496 UTSW 2 182000196 nonsense probably null
R1922:Gm14496 UTSW 2 182001004 missense probably benign 0.22
R2081:Gm14496 UTSW 2 182000479 missense probably damaging 1.00
R2102:Gm14496 UTSW 2 181991334 missense possibly damaging 0.88
R2176:Gm14496 UTSW 2 181991337 missense probably benign
R4154:Gm14496 UTSW 2 181995079 missense probably benign 0.01
R4789:Gm14496 UTSW 2 181995784 missense possibly damaging 0.85
R4873:Gm14496 UTSW 2 181997433 missense probably damaging 0.99
R4875:Gm14496 UTSW 2 181997433 missense probably damaging 0.99
R5020:Gm14496 UTSW 2 181991359 missense possibly damaging 0.67
R5354:Gm14496 UTSW 2 182000809 missense probably damaging 1.00
R5361:Gm14496 UTSW 2 182000354 missense probably benign 0.07
R5457:Gm14496 UTSW 2 181997608 missense probably damaging 0.96
R5589:Gm14496 UTSW 2 181995881 nonsense probably null
R5655:Gm14496 UTSW 2 181996182 missense probably benign 0.06
R6007:Gm14496 UTSW 2 181997530 missense probably benign 0.37
R6123:Gm14496 UTSW 2 181991227 start codon destroyed probably null 1.00
R6159:Gm14496 UTSW 2 181996257 missense probably benign 0.01
R6168:Gm14496 UTSW 2 182000957 missense probably damaging 1.00
R6454:Gm14496 UTSW 2 181996222 missense probably damaging 0.97
R6502:Gm14496 UTSW 2 182000593 missense probably benign 0.01
R6649:Gm14496 UTSW 2 181997476 missense possibly damaging 0.83
R6996:Gm14496 UTSW 2 181996204 missense probably damaging 1.00
R7043:Gm14496 UTSW 2 182000327 missense possibly damaging 0.70
R7317:Gm14496 UTSW 2 181995820 missense possibly damaging 0.56
R7354:Gm14496 UTSW 2 182000686 missense probably damaging 1.00
R7565:Gm14496 UTSW 2 181991257 missense possibly damaging 0.84
R7565:Gm14496 UTSW 2 182000837 missense probably damaging 0.99
R7669:Gm14496 UTSW 2 181995918 missense possibly damaging 0.95
X0058:Gm14496 UTSW 2 181995986 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCTCTGTCATTGCCTTCCACT -3'
(R):5'- GTGCTTCACACTCTGCTAACATTCACT -3'

Sequencing Primer
(F):5'- GGAACCTTCCTGACAGATTCAATG -3'
(R):5'- gtttgtttgtttgtttggtttttttg -3'
Posted On2014-04-24