Mutagenetix > Incidental Mutations

Incidental Mutation 'R1635:Cc2d2a'

173057

Institutional Source

Beutler Lab

Gene Symbol

Cc2d2a

Ensembl Gene

ENSMUSG00000039765

Gene Name

coiled-coil and C2 domain containing 2A

Synonyms

b2b1035Clo, 5730509K17Rik

Accession Numbers

Genbank: NM_172274; MGI: 1924487

Is this an essential gene?

Probably essential (E-score: 0.914) question?

Stock #

R1635 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43662346-43740972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43722470 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 1076 (W1076R)

Ref Sequence

ENSEMBL: ENSMUSP00000114349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048150
AA Change: W1130R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: W1130R

Domain	Start	End	E-Value	Type
low complexity region	26	41	N/A	INTRINSIC
low complexity region	58	67	N/A	INTRINSIC
low complexity region	124	136	N/A	INTRINSIC
low complexity region	203	217	N/A	INTRINSIC
coiled coil region	472	501	N/A	INTRINSIC
coiled coil region	553	582	N/A	INTRINSIC
Pfam:CC2D2AN-C2	645	817	2e-36	PFAM
low complexity region	1005	1017	N/A	INTRINSIC
low complexity region	1024	1036	N/A	INTRINSIC
C2	1048	1208	3.43e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125866
AA Change: W1076R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: W1076R

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	154	168	N/A	INTRINSIC
coiled coil region	423	452	N/A	INTRINSIC
coiled coil region	504	533	N/A	INTRINSIC
Pfam:CC2D2AN-C2	596	768	7.7e-44	PFAM
low complexity region	970	982	N/A	INTRINSIC
C2	994	1154	2.3e-7	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	A	T	2: 25,444,856	I1947F	probably benign	Het
Adgrd1	G	T	5: 129,128,907	V182F	probably damaging	Het
Agmat	A	G	4: 141,747,069	D87G	probably damaging	Het
AI182371	T	C	2: 35,088,737		probably null	Het
Anapc1	G	T	2: 128,628,532	H1559Q	probably damaging	Het
Ankar	T	C	1: 72,650,138	Y1278C	probably damaging	Het
Arhgef2	A	T	3: 88,639,321		probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Banp	A	T	8: 122,001,011	I130F	probably damaging	Het
C130050O18Rik	G	T	5: 139,414,493	R100S	probably benign	Het
Carmil3	A	G	14: 55,496,282	T374A	possibly damaging	Het
Cdc34	T	G	10: 79,688,054	S235A	probably benign	Het
Cdh8	G	T	8: 99,031,024	H647Q	probably damaging	Het
Cdk1	A	T	10: 69,338,547	L282Q	probably damaging	Het
Ceacam3	A	G	7: 17,159,977	D471G	probably damaging	Het
Cltc	A	T	11: 86,757,279	I4N	probably benign	Het
Cntfr	T	A	4: 41,658,816	E305V	probably damaging	Het
Cwh43	T	A	5: 73,434,310	I496N	probably damaging	Het
Cyp2f2	A	G	7: 27,129,724	N218S	probably benign	Het
D16Ertd472e	A	G	16: 78,546,504		probably null	Het
Dab2	A	G	15: 6,429,870	Q400R	possibly damaging	Het
Dapl1	A	T	2: 59,496,562	I51F	probably benign	Het
Drc7	G	A	8: 95,074,332		probably null	Het
Etl4	A	G	2: 20,806,408	T1101A	probably damaging	Het
Fam83c	C	A	2: 155,830,051	R488M	possibly damaging	Het
Fam96b	A	T	8: 104,640,988	I108N	possibly damaging	Het
Fbxo42	A	G	4: 141,200,529	T707A	probably damaging	Het
Fcmr	A	T	1: 130,876,185		probably null	Het
Fer1l6	G	C	15: 58,647,081	K1687N	probably damaging	Het
Fgd4	G	A	16: 16,475,029	R275*	probably null	Het
Fxr2	G	A	11: 69,641,313	C87Y	possibly damaging	Het
Gja4	A	T	4: 127,312,679	I97N	probably damaging	Het
Gm136	A	G	4: 34,750,919		probably null	Het
Gm14496	A	G	2: 182,001,044	D836G	possibly damaging	Het
Gm8882	A	G	6: 132,363,006		probably null	Het
Grm3	T	A	5: 9,511,520	T777S	probably damaging	Het
Guca2b	A	G	4: 119,657,715	Y50H	probably damaging	Het
Herc2	C	T	7: 56,136,667	P1587S	probably benign	Het
Hmcn1	C	T	1: 150,669,558	S2766N	probably benign	Het
Idi2	T	A	13: 8,959,419	I224K	probably damaging	Het
Kmt2a	A	T	9: 44,824,369		probably benign	Het
Lonp2	A	T	8: 86,713,450	M693L	possibly damaging	Het
Megf8	G	T	7: 25,346,747	M1525I	possibly damaging	Het
Mgme1	T	C	2: 144,279,098	V276A	possibly damaging	Het
Mief2	G	T	11: 60,731,408	W268L	probably damaging	Het
Mpped1	C	T	15: 83,791,990		probably benign	Het
Mreg	T	C	1: 72,192,197	N34S	probably benign	Het
Myf6	T	C	10: 107,494,673	Y11C	probably damaging	Het
Myh9	C	A	15: 77,771,167	Q1196H	probably benign	Het
Myh9	A	T	15: 77,775,899	D56E	probably benign	Het
Myo5c	A	T	9: 75,277,075	R949S	probably benign	Het
Ncapg2	TAA	TA	12: 116,434,685		probably null	Het
Nfx1	T	A	4: 40,977,004	V226E	probably benign	Het
Nlrp10	T	A	7: 108,924,530	K581M	possibly damaging	Het
Nmd3	T	G	3: 69,739,984	I273S	probably benign	Het
Olfr1264	A	T	2: 90,021,970	I32N	possibly damaging	Het
P4hb	T	C	11: 120,571,616	E88G	probably damaging	Het
Pcnx3	A	T	19: 5,665,745	H1444Q	probably benign	Het
Pdia4	A	T	6: 47,799,199	F421L	possibly damaging	Het
Picalm	T	A	7: 90,191,251	S538T	probably damaging	Het
Ppp2r2b	T	A	18: 43,059,210	I11F	probably benign	Het
Ptk7	C	T	17: 46,573,534	E757K	possibly damaging	Het
Rbm22	T	G	18: 60,561,268	C24W	probably damaging	Het
Rev3l	A	G	10: 39,806,662	D288G	probably damaging	Het
Rgs18	T	A	1: 144,754,053	H156L	probably benign	Het
Rnf213	A	G	11: 119,442,579	I2871M	probably damaging	Het
Rrm2b	A	T	15: 37,945,084	M137K	probably damaging	Het
Rrp12	A	T	19: 41,868,785	D1183E	probably benign	Het
Sacs	G	A	14: 61,203,828	V1108M	probably damaging	Het
Scube2	A	T	7: 109,843,214	D270E	possibly damaging	Het
Serpina3a	T	A	12: 104,116,478	F170Y	probably damaging	Het
Serpinb3b	T	C	1: 107,154,673	E287G	probably benign	Het
Slamf8	C	T	1: 172,584,619	V130M	probably damaging	Het
Slc5a3	T	C	16: 92,077,396	S114P	possibly damaging	Het
Sos1	T	A	17: 80,422,679		probably null	Het
Sox10	A	T	15: 79,156,460	D293E	probably damaging	Het
Sphk1	A	G	11: 116,535,770	D177G	probably damaging	Het
Sphkap	T	G	1: 83,278,400	M543L	probably benign	Het
Syt13	A	T	2: 92,953,415	K343N	probably damaging	Het
Tatdn3	A	G	1: 191,060,176	M34T	probably benign	Het
Timd4	T	G	11: 46,842,162	V305G	possibly damaging	Het
Tnnc2	T	C	2: 164,777,592	I111V	probably benign	Het
Togaram2	C	T	17: 71,697,851	P301L	probably benign	Het
Trpc3	T	C	3: 36,640,627	N726S	probably damaging	Het
Tspear	T	A	10: 77,870,419	L341H	possibly damaging	Het
Ugt1a5	T	A	1: 88,166,083		probably benign	Het
Ulk3	A	T	9: 57,593,160		probably null	Het
Unc5d	T	A	8: 28,760,749	I297L	probably benign	Het
Usp20	A	G	2: 31,018,818	I804V	probably benign	Het
Usp22	G	T	11: 61,161,318	C278*	probably null	Het
Usp53	A	T	3: 122,934,223	N903K	probably benign	Het
V1rd19	T	C	7: 24,003,387	F93L	probably benign	Het
Zdbf2	T	A	1: 63,304,334	V624E	possibly damaging	Het
Zfyve16	A	T	13: 92,509,020	S1073T	probably damaging	Het
Zkscan8	T	C	13: 21,526,595	H115R	possibly damaging	Het

Other mutations in Cc2d2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Cc2d2a	APN	5	43724380	splice site	probably benign
IGL00937:Cc2d2a	APN	5	43688122	critical splice acceptor site	probably null
IGL01322:Cc2d2a	APN	5	43689003	missense	probably benign	0.00
IGL01349:Cc2d2a	APN	5	43723784	missense	probably benign	0.01
IGL01448:Cc2d2a	APN	5	43684185	missense	possibly damaging	0.65
IGL01871:Cc2d2a	APN	5	43688969	missense	probably damaging	0.98
IGL01947:Cc2d2a	APN	5	43688237	missense	probably damaging	0.96
IGL01976:Cc2d2a	APN	5	43683115	missense	probably benign	0.02
IGL02113:Cc2d2a	APN	5	43685248	splice site	probably null
IGL02364:Cc2d2a	APN	5	43735450	missense	probably damaging	1.00
IGL02448:Cc2d2a	APN	5	43683205	splice site	probably benign
IGL02458:Cc2d2a	APN	5	43718554	missense	probably benign	0.01
IGL02542:Cc2d2a	APN	5	43688910	splice site	probably benign
IGL02834:Cc2d2a	APN	5	43714521	nonsense	probably null
IGL02940:Cc2d2a	APN	5	43728294	splice site	probably null
IGL03003:Cc2d2a	APN	5	43671266	missense	probably benign	0.22
IGL03183:Cc2d2a	APN	5	43732379	missense	probably damaging	1.00
C9142:Cc2d2a	UTSW	5	43735457	splice site	probably benign
P0028:Cc2d2a	UTSW	5	43684199	missense	probably benign
R0193:Cc2d2a	UTSW	5	43736118	missense	probably damaging	1.00
R0201:Cc2d2a	UTSW	5	43737512	missense	probably damaging	1.00
R0211:Cc2d2a	UTSW	5	43688266	splice site	probably null
R0243:Cc2d2a	UTSW	5	43696638	splice site	probably benign
R0317:Cc2d2a	UTSW	5	43706901	critical splice donor site	probably null
R0453:Cc2d2a	UTSW	5	43703294	missense	probably benign	0.00
R0558:Cc2d2a	UTSW	5	43724387	splice site	probably benign
R0624:Cc2d2a	UTSW	5	43730029	missense	probably benign
R0634:Cc2d2a	UTSW	5	43681381	splice site	probably benign
R1503:Cc2d2a	UTSW	5	43695239	missense	probably damaging	1.00
R1686:Cc2d2a	UTSW	5	43739371	missense	possibly damaging	0.81
R1707:Cc2d2a	UTSW	5	43723688	splice site	probably null
R1715:Cc2d2a	UTSW	5	43718661	missense	probably damaging	0.97
R1765:Cc2d2a	UTSW	5	43714531	missense	probably damaging	0.99
R1794:Cc2d2a	UTSW	5	43688252	missense	probably damaging	1.00
R1881:Cc2d2a	UTSW	5	43740828	missense	probably damaging	0.99
R1917:Cc2d2a	UTSW	5	43706222	missense	probably damaging	1.00
R2005:Cc2d2a	UTSW	5	43726373	critical splice donor site	probably null
R2201:Cc2d2a	UTSW	5	43684033	splice site	probably benign
R2244:Cc2d2a	UTSW	5	43732433	missense	probably damaging	1.00
R2368:Cc2d2a	UTSW	5	43703888	missense	probably benign
R2442:Cc2d2a	UTSW	5	43671305	critical splice donor site	probably null
R2511:Cc2d2a	UTSW	5	43735395	missense	probably damaging	0.99
R3023:Cc2d2a	UTSW	5	43685251	splice site	probably null
R3147:Cc2d2a	UTSW	5	43709155	missense	probably damaging	1.00
R3148:Cc2d2a	UTSW	5	43709155	missense	probably damaging	1.00
R3426:Cc2d2a	UTSW	5	43736109	missense	probably benign	0.00
R3609:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3610:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3611:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3839:Cc2d2a	UTSW	5	43718714	missense	probably benign
R3870:Cc2d2a	UTSW	5	43718691	nonsense	probably null
R4334:Cc2d2a	UTSW	5	43683134	missense	probably benign	0.00
R4913:Cc2d2a	UTSW	5	43739323	missense	probably benign	0.12
R5179:Cc2d2a	UTSW	5	43688221	missense	possibly damaging	0.82
R5315:Cc2d2a	UTSW	5	43720433	missense	probably damaging	0.99
R5352:Cc2d2a	UTSW	5	43706213	missense	probably damaging	1.00
R5386:Cc2d2a	UTSW	5	43730041	missense	probably benign	0.01
R5538:Cc2d2a	UTSW	5	43695176	missense	possibly damaging	0.94
R5568:Cc2d2a	UTSW	5	43709091	missense	probably damaging	0.99
R5618:Cc2d2a	UTSW	5	43729907	missense	probably benign	0.00
R5653:Cc2d2a	UTSW	5	43722462	missense	possibly damaging	0.81
R5817:Cc2d2a	UTSW	5	43712418	missense	probably damaging	1.00
R5858:Cc2d2a	UTSW	5	43715775	missense	probably damaging	1.00
R5905:Cc2d2a	UTSW	5	43712426	missense	probably benign
R5912:Cc2d2a	UTSW	5	43720430	missense	probably damaging	0.97
R6073:Cc2d2a	UTSW	5	43729975	missense	probably damaging	1.00
R6084:Cc2d2a	UTSW	5	43668673	missense	probably benign
R6142:Cc2d2a	UTSW	5	43703198	missense	probably damaging	0.97
R6176:Cc2d2a	UTSW	5	43709113	missense	probably benign	0.32
R6238:Cc2d2a	UTSW	5	43671235	missense	probably benign	0.11
R6381:Cc2d2a	UTSW	5	43715776	missense	possibly damaging	0.69
R6404:Cc2d2a	UTSW	5	43704074	missense	possibly damaging	0.58
R6455:Cc2d2a	UTSW	5	43739412	missense	possibly damaging	0.69
R6695:Cc2d2a	UTSW	5	43718677	missense	probably damaging	0.99
R6805:Cc2d2a	UTSW	5	43681331	missense	probably damaging	1.00
R6919:Cc2d2a	UTSW	5	43703215	missense	probably benign	0.19
R6970:Cc2d2a	UTSW	5	43718585	missense	probably damaging	1.00
R7024:Cc2d2a	UTSW	5	43733929	missense	probably benign	0.10
R7054:Cc2d2a	UTSW	5	43699979	nonsense	probably null
R7071:Cc2d2a	UTSW	5	43709113	missense	probably benign	0.13
R7098:Cc2d2a	UTSW	5	43683139	missense	probably benign	0.00
R7366:Cc2d2a	UTSW	5	43729990	missense	probably damaging	1.00
R7908:Cc2d2a	UTSW	5	43706846	missense	probably benign	0.00
R7920:Cc2d2a	UTSW	5	43739309	missense	probably benign	0.09
R7950:Cc2d2a	UTSW	5	43695296	critical splice donor site	probably null
R8007:Cc2d2a	UTSW	5	43706100	missense	possibly damaging	0.71
R8117:Cc2d2a	UTSW	5	43712439	missense	probably damaging	1.00
R8123:Cc2d2a	UTSW	5	43710554	missense	probably benign
R8179:Cc2d2a	UTSW	5	43699953	missense	probably damaging	0.96
R8279:Cc2d2a	UTSW	5	43736145	missense	probably benign	0.01
R8293:Cc2d2a	UTSW	5	43688228	missense	probably damaging	0.97
R8482:Cc2d2a	UTSW	5	43695239	missense	probably damaging	1.00
Z1177:Cc2d2a	UTSW	5	43703204	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTCCTGAACAGACTTCCTGTTTCATTC -3'
(R):5'- AGGGCATTTTGGGCACTAAACTAGTAAA -3'

Sequencing Primer
(F):5'- TGCCTGAGATAGAAAATGTTCAC -3'
(R):5'- tctttttctcttttctcttctcttcc -3'

Posted On

2014-04-24