Incidental Mutation 'R1636:Lmbrd1'
ID173135
Institutional Source Beutler Lab
Gene Symbol Lmbrd1
Ensembl Gene ENSMUSG00000073725
Gene NameLMBR1 domain containing 1
Synonyms0910001K20Rik
MMRRC Submission 039672-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1636 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location24678630-24766301 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 24746930 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 435 (Y435*)
Ref Sequence ENSEMBL: ENSMUSP00000140783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095062] [ENSMUST00000191471]
Predicted Effect probably null
Transcript: ENSMUST00000095062
AA Change: Y365*
SMART Domains Protein: ENSMUSP00000092672
Gene: ENSMUSG00000073725
AA Change: Y365*

DomainStartEndE-ValueType
Pfam:LMBR1 17 292 3e-24 PFAM
transmembrane domain 303 325 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
low complexity region 522 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187468
Predicted Effect probably null
Transcript: ENSMUST00000190195
AA Change: Y74*
Predicted Effect probably null
Transcript: ENSMUST00000191471
AA Change: Y435*
SMART Domains Protein: ENSMUSP00000140783
Gene: ENSMUSG00000073725
AA Change: Y435*

DomainStartEndE-ValueType
Pfam:LMBR1 12 289 2.7e-19 PFAM
transmembrane domain 303 325 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
low complexity region 522 531 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 96% (85/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal membrane protein that may be involved in the transport and metabolism of cobalamin. This protein also interacts with the large form of the hepatitis delta antigen and may be required for the nucleocytoplasmic shuttling of the hepatitis delta virus. Mutations in this gene are associated with the vitamin B12 metabolism disorder termed, homocystinuria-megaloblastic anemia complementation type F.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice heterozygous for a targeted allele exhibit increased cardiac cell glucose uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Abca7 A G 10: 80,008,998 H1518R probably benign Het
Adam4 A G 12: 81,419,690 L719S probably damaging Het
Adprm T C 11: 67,041,723 Y120C possibly damaging Het
Arhgap25 T A 6: 87,495,941 Y78F probably damaging Het
Asap1 G A 15: 64,123,912 P665L probably damaging Het
Bank1 T C 3: 136,083,226 K637R probably damaging Het
BC005561 T A 5: 104,520,750 M1046K probably damaging Het
Bcr T A 10: 75,131,066 L502M probably damaging Het
Brwd1 A G 16: 96,059,641 L315P probably damaging Het
Btbd7 A T 12: 102,793,851 Y613N probably damaging Het
Cdca7l G A 12: 117,876,928 R395H probably damaging Het
Cftr T A 6: 18,226,157 I368K probably damaging Het
D6Wsu163e T C 6: 126,946,601 V150A possibly damaging Het
Ddx52 A G 11: 83,955,343 T470A probably damaging Het
Def6 A G 17: 28,223,918 E316G possibly damaging Het
Dip2a A T 10: 76,321,578 N64K probably benign Het
Dlgap4 G T 2: 156,746,077 E631* probably null Het
Dner T C 1: 84,585,330 K190E possibly damaging Het
Eif2b4 T A 5: 31,192,266 probably null Het
Eif3a A T 19: 60,781,905 D119E possibly damaging Het
Ercc2 C T 7: 19,387,124 T276M possibly damaging Het
Exoc1 A G 5: 76,568,118 K830R probably benign Het
F2r G T 13: 95,603,892 Y378* probably null Het
Fam186a G A 15: 99,941,658 T2235I unknown Het
Fmo3 T G 1: 162,954,425 K453T probably benign Het
Fzd3 A T 14: 65,253,106 D9E probably benign Het
Galns A G 8: 122,604,216 probably benign Het
Gm1818 T C 12: 48,555,767 noncoding transcript Het
Gm9955 C A 18: 24,709,230 probably benign Het
Immp2l T C 12: 41,703,687 V113A probably damaging Het
Iyd T A 10: 3,545,588 M82K possibly damaging Het
Kif21a A T 15: 90,984,805 probably benign Het
Lipf A G 19: 33,976,535 D342G probably damaging Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mtrf1l A G 10: 5,813,265 S355P probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neo1 T C 9: 58,913,277 S788G probably damaging Het
Nfx1 T G 4: 41,016,072 probably null Het
Nlrp4c T C 7: 6,066,738 V546A possibly damaging Het
Nwd2 G A 5: 63,807,557 V1495M probably damaging Het
Oaf T A 9: 43,239,324 I84F probably benign Het
Obscn A G 11: 59,122,637 F1153S probably damaging Het
Ofcc1 A T 13: 40,180,428 C396S possibly damaging Het
Olfr576 T G 7: 102,965,691 I197S possibly damaging Het
Olfr955 T C 9: 39,469,919 D269G probably benign Het
Omg A G 11: 79,502,340 S231P probably benign Het
Pdcl3 A G 1: 38,994,935 T53A possibly damaging Het
Pik3r2 A T 8: 70,771,898 H244Q probably benign Het
Pinx1 A T 14: 63,866,137 H55L probably damaging Het
Pwwp2b T A 7: 139,254,842 H66Q probably benign Het
Rell2 A G 18: 37,958,079 D99G probably damaging Het
Reln G A 5: 21,998,683 A1191V probably damaging Het
Rprm T C 2: 54,085,304 M1V probably null Het
Sav1 A C 12: 69,984,495 H84Q probably benign Het
Scamp5 T C 9: 57,451,409 D28G possibly damaging Het
Selenbp2 G A 3: 94,696,815 G9D probably damaging Het
Sh3tc2 T C 18: 61,989,721 W518R probably damaging Het
Slc10a6 A T 5: 103,629,146 N29K probably benign Het
Spindoc C A 19: 7,374,557 D142Y probably damaging Het
Spink12 T A 18: 44,107,728 D60E probably benign Het
Sugt1 A G 14: 79,587,982 I23V probably benign Het
Syne2 T C 12: 76,004,732 C4079R probably benign Het
Tex15 T G 8: 33,576,387 Y1948* probably null Het
Tln2 T C 9: 67,306,532 E321G probably damaging Het
Tmem198b A G 10: 128,802,196 L166P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttn T A 2: 76,900,222 probably benign Het
Unc13a G A 8: 71,653,390 T690I probably damaging Het
Ush2a T C 1: 188,466,176 I1479T possibly damaging Het
Vcan G A 13: 89,703,667 T1058I possibly damaging Het
Vmn1r84 T C 7: 12,362,595 Q45R probably benign Het
Vmn2r111 T C 17: 22,571,399 N209D probably damaging Het
Wbp1l A G 19: 46,644,444 Y40C probably damaging Het
Wdr72 A T 9: 74,179,625 H625L probably benign Het
Zeb2 T C 2: 45,002,611 Y195C probably damaging Het
Zkscan6 C T 11: 65,814,430 probably benign Het
Zmym6 C A 4: 127,123,767 H1022N probably damaging Het
Other mutations in Lmbrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Lmbrd1 APN 1 24705974 splice site probably benign
IGL01897:Lmbrd1 APN 1 24743896 missense possibly damaging 0.47
IGL01950:Lmbrd1 APN 1 24711602 critical splice donor site probably null
IGL02342:Lmbrd1 APN 1 24704878 missense probably damaging 1.00
IGL02888:Lmbrd1 APN 1 24714972 missense possibly damaging 0.94
P0033:Lmbrd1 UTSW 1 24685565 missense possibly damaging 0.95
R0479:Lmbrd1 UTSW 1 24746797 splice site probably benign
R0549:Lmbrd1 UTSW 1 24744920 missense probably benign 0.17
R1015:Lmbrd1 UTSW 1 24731878 nonsense probably null
R1423:Lmbrd1 UTSW 1 24746878 missense probably damaging 0.99
R1650:Lmbrd1 UTSW 1 24711558 missense probably damaging 0.97
R1815:Lmbrd1 UTSW 1 24685561 missense possibly damaging 0.55
R2354:Lmbrd1 UTSW 1 24685541 missense probably damaging 1.00
R3690:Lmbrd1 UTSW 1 24762293 makesense probably null
R3713:Lmbrd1 UTSW 1 24692995 missense probably damaging 1.00
R4241:Lmbrd1 UTSW 1 24692968 nonsense probably null
R4627:Lmbrd1 UTSW 1 24705999 missense probably damaging 1.00
R4782:Lmbrd1 UTSW 1 24744975 splice site probably null
R4799:Lmbrd1 UTSW 1 24744975 splice site probably null
R5341:Lmbrd1 UTSW 1 24746811 nonsense probably null
R5430:Lmbrd1 UTSW 1 24692980 missense possibly damaging 0.95
R5483:Lmbrd1 UTSW 1 24744908 missense probably damaging 1.00
R5633:Lmbrd1 UTSW 1 24748862 missense possibly damaging 0.90
R6188:Lmbrd1 UTSW 1 24711545 missense probably benign
R6383:Lmbrd1 UTSW 1 24706034 missense probably damaging 0.99
R6617:Lmbrd1 UTSW 1 24685428 missense probably damaging 1.00
R7060:Lmbrd1 UTSW 1 24692966 missense probably benign 0.00
R7365:Lmbrd1 UTSW 1 24744867 missense possibly damaging 0.62
R7621:Lmbrd1 UTSW 1 24728544 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTCCACAGAAGGACTGGACGTTTC -3'
(R):5'- GTTCCTCTCACCAAGTTACAGCAGG -3'

Sequencing Primer
(F):5'- GACTGGACGTTTCAAAATAATGTTGG -3'
(R):5'- GAACACTTAGCTTAGTGTCATAGG -3'
Posted On2014-04-24