Incidental Mutation 'R1636:Zeb2'
ID173141
Institutional Source Beutler Lab
Gene Symbol Zeb2
Ensembl Gene ENSMUSG00000026872
Gene Namezinc finger E-box binding homeobox 2
SynonymsZfhx1b, Zfx1b, SIP1, 9130203F04Rik, D130016B08Rik
MMRRC Submission 039672-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1636 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location44983632-45117395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45002611 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 195 (Y195C)
Ref Sequence ENSEMBL: ENSMUSP00000144637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028229] [ENSMUST00000068415] [ENSMUST00000076836] [ENSMUST00000176438] [ENSMUST00000176732] [ENSMUST00000177302] [ENSMUST00000200844] [ENSMUST00000201211] [ENSMUST00000201623] [ENSMUST00000201804] [ENSMUST00000201969]
Predicted Effect probably benign
Transcript: ENSMUST00000028229
AA Change: Y210C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000028229
Gene: ENSMUSG00000026872
AA Change: Y210C

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068415
AA Change: Y166C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069685
Gene: ENSMUSG00000026872
AA Change: Y166C

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076836
AA Change: Y165C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000076111
Gene: ENSMUSG00000026872
AA Change: Y165C

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 210 233 2.09e-3 SMART
ZnF_C2H2 240 262 9.88e-5 SMART
ZnF_C2H2 281 303 4.87e-4 SMART
ZnF_C2H2 309 329 1.86e1 SMART
low complexity region 351 363 N/A INTRINSIC
ZnF_C2H2 580 600 5.54e1 SMART
HOX 643 705 2.05e-3 SMART
low complexity region 777 807 N/A INTRINSIC
low complexity region 840 855 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
ZnF_C2H2 998 1020 4.47e-3 SMART
ZnF_C2H2 1026 1048 2.17e-1 SMART
ZnF_C2H2 1054 1075 1.89e-1 SMART
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1133 1149 N/A INTRINSIC
low complexity region 1157 1167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176438
AA Change: Y166C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134849
Gene: ENSMUSG00000026872
AA Change: Y166C

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176732
SMART Domains Protein: ENSMUSP00000135393
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
ZnF_C2H2 60 83 2.09e-3 SMART
ZnF_C2H2 90 112 9.88e-5 SMART
ZnF_C2H2 131 153 4.87e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177302
AA Change: Y166C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134747
Gene: ENSMUSG00000026872
AA Change: Y166C

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200844
AA Change: Y142C

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144421
Gene: ENSMUSG00000026872
AA Change: Y142C

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 187 210 9.2e-6 SMART
ZnF_C2H2 217 239 4.2e-7 SMART
ZnF_C2H2 258 280 2e-6 SMART
ZnF_C2H2 286 306 8e-2 SMART
low complexity region 328 340 N/A INTRINSIC
ZnF_C2H2 557 577 2.4e-1 SMART
HOX 620 682 1.1e-5 SMART
low complexity region 754 784 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
ZnF_C2H2 975 997 1.9e-5 SMART
ZnF_C2H2 1003 1025 9.6e-4 SMART
ZnF_C2H2 1031 1052 7.9e-4 SMART
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1110 1126 N/A INTRINSIC
low complexity region 1134 1144 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201211
AA Change: Y142C

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144406
Gene: ENSMUSG00000026872
AA Change: Y142C

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201413
Predicted Effect possibly damaging
Transcript: ENSMUST00000201623
AA Change: Y142C

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144075
Gene: ENSMUSG00000026872
AA Change: Y142C

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 187 210 9.2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201804
AA Change: Y195C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144637
Gene: ENSMUSG00000026872
AA Change: Y195C

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
ZnF_C2H2 240 263 9.2e-6 SMART
ZnF_C2H2 270 292 4.2e-7 SMART
ZnF_C2H2 311 333 2e-6 SMART
ZnF_C2H2 339 359 8e-2 SMART
low complexity region 381 393 N/A INTRINSIC
ZnF_C2H2 610 630 2.4e-1 SMART
HOX 673 731 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201969
SMART Domains Protein: ENSMUSP00000144141
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209076
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 96% (85/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Zfh1 family of 2-handed zinc finger/homeodomain proteins. It is located in the nucleus and functions as a DNA-binding transcriptional repressor that interacts with activated SMADs. Mutations in this gene are associated with Hirschsprung disease/Mowat-Wilson syndrome. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous null mutants exhibit a variety of defects at embryonic day 8.5 and die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Abca7 A G 10: 80,008,998 H1518R probably benign Het
Adam4 A G 12: 81,419,690 L719S probably damaging Het
Adprm T C 11: 67,041,723 Y120C possibly damaging Het
Arhgap25 T A 6: 87,495,941 Y78F probably damaging Het
Asap1 G A 15: 64,123,912 P665L probably damaging Het
Bank1 T C 3: 136,083,226 K637R probably damaging Het
BC005561 T A 5: 104,520,750 M1046K probably damaging Het
Bcr T A 10: 75,131,066 L502M probably damaging Het
Brwd1 A G 16: 96,059,641 L315P probably damaging Het
Btbd7 A T 12: 102,793,851 Y613N probably damaging Het
Cdca7l G A 12: 117,876,928 R395H probably damaging Het
Cftr T A 6: 18,226,157 I368K probably damaging Het
D6Wsu163e T C 6: 126,946,601 V150A possibly damaging Het
Ddx52 A G 11: 83,955,343 T470A probably damaging Het
Def6 A G 17: 28,223,918 E316G possibly damaging Het
Dip2a A T 10: 76,321,578 N64K probably benign Het
Dlgap4 G T 2: 156,746,077 E631* probably null Het
Dner T C 1: 84,585,330 K190E possibly damaging Het
Eif2b4 T A 5: 31,192,266 probably null Het
Eif3a A T 19: 60,781,905 D119E possibly damaging Het
Ercc2 C T 7: 19,387,124 T276M possibly damaging Het
Exoc1 A G 5: 76,568,118 K830R probably benign Het
F2r G T 13: 95,603,892 Y378* probably null Het
Fam186a G A 15: 99,941,658 T2235I unknown Het
Fmo3 T G 1: 162,954,425 K453T probably benign Het
Fzd3 A T 14: 65,253,106 D9E probably benign Het
Galns A G 8: 122,604,216 probably benign Het
Gm1818 T C 12: 48,555,767 noncoding transcript Het
Gm9955 C A 18: 24,709,230 probably benign Het
Immp2l T C 12: 41,703,687 V113A probably damaging Het
Iyd T A 10: 3,545,588 M82K possibly damaging Het
Kif21a A T 15: 90,984,805 probably benign Het
Lipf A G 19: 33,976,535 D342G probably damaging Het
Lmbrd1 C A 1: 24,746,930 Y435* probably null Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mtrf1l A G 10: 5,813,265 S355P probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neo1 T C 9: 58,913,277 S788G probably damaging Het
Nfx1 T G 4: 41,016,072 probably null Het
Nlrp4c T C 7: 6,066,738 V546A possibly damaging Het
Nwd2 G A 5: 63,807,557 V1495M probably damaging Het
Oaf T A 9: 43,239,324 I84F probably benign Het
Obscn A G 11: 59,122,637 F1153S probably damaging Het
Ofcc1 A T 13: 40,180,428 C396S possibly damaging Het
Olfr576 T G 7: 102,965,691 I197S possibly damaging Het
Olfr955 T C 9: 39,469,919 D269G probably benign Het
Omg A G 11: 79,502,340 S231P probably benign Het
Pdcl3 A G 1: 38,994,935 T53A possibly damaging Het
Pik3r2 A T 8: 70,771,898 H244Q probably benign Het
Pinx1 A T 14: 63,866,137 H55L probably damaging Het
Pwwp2b T A 7: 139,254,842 H66Q probably benign Het
Rell2 A G 18: 37,958,079 D99G probably damaging Het
Reln G A 5: 21,998,683 A1191V probably damaging Het
Rprm T C 2: 54,085,304 M1V probably null Het
Sav1 A C 12: 69,984,495 H84Q probably benign Het
Scamp5 T C 9: 57,451,409 D28G possibly damaging Het
Selenbp2 G A 3: 94,696,815 G9D probably damaging Het
Sh3tc2 T C 18: 61,989,721 W518R probably damaging Het
Slc10a6 A T 5: 103,629,146 N29K probably benign Het
Spindoc C A 19: 7,374,557 D142Y probably damaging Het
Spink12 T A 18: 44,107,728 D60E probably benign Het
Sugt1 A G 14: 79,587,982 I23V probably benign Het
Syne2 T C 12: 76,004,732 C4079R probably benign Het
Tex15 T G 8: 33,576,387 Y1948* probably null Het
Tln2 T C 9: 67,306,532 E321G probably damaging Het
Tmem198b A G 10: 128,802,196 L166P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttn T A 2: 76,900,222 probably benign Het
Unc13a G A 8: 71,653,390 T690I probably damaging Het
Ush2a T C 1: 188,466,176 I1479T possibly damaging Het
Vcan G A 13: 89,703,667 T1058I possibly damaging Het
Vmn1r84 T C 7: 12,362,595 Q45R probably benign Het
Vmn2r111 T C 17: 22,571,399 N209D probably damaging Het
Wbp1l A G 19: 46,644,444 Y40C probably damaging Het
Wdr72 A T 9: 74,179,625 H625L probably benign Het
Zkscan6 C T 11: 65,814,430 probably benign Het
Zmym6 C A 4: 127,123,767 H1022N probably damaging Het
Other mutations in Zeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Zeb2 APN 2 44997275 missense probably damaging 1.00
IGL01639:Zeb2 APN 2 44997257 missense probably benign
IGL02016:Zeb2 APN 2 44988874 missense possibly damaging 0.71
IGL02337:Zeb2 APN 2 44997230 missense probably damaging 0.96
IGL02745:Zeb2 APN 2 44994475 unclassified probably benign
IGL02893:Zeb2 APN 2 44996607 missense probably benign 0.03
IGL03412:Zeb2 APN 2 45002708 intron probably benign
Dropped UTSW 2 45110041 missense possibly damaging 0.66
Okapi UTSW 2 44997156 missense probably damaging 1.00
sable UTSW 2 44997318 missense probably damaging 1.00
R0514:Zeb2 UTSW 2 45002647 missense possibly damaging 0.52
R0603:Zeb2 UTSW 2 45017426 missense probably benign 0.45
R0608:Zeb2 UTSW 2 44996126 missense possibly damaging 0.87
R1236:Zeb2 UTSW 2 44994646 missense probably damaging 1.00
R1529:Zeb2 UTSW 2 44997194 missense probably damaging 1.00
R1581:Zeb2 UTSW 2 44997000 missense probably damaging 0.99
R1924:Zeb2 UTSW 2 45002612 missense probably damaging 1.00
R2012:Zeb2 UTSW 2 44997950 missense probably damaging 1.00
R2097:Zeb2 UTSW 2 44997156 missense probably damaging 1.00
R2156:Zeb2 UTSW 2 44988809 missense probably benign 0.20
R4385:Zeb2 UTSW 2 45023062 missense probably damaging 1.00
R4472:Zeb2 UTSW 2 45023011 missense probably damaging 1.00
R4678:Zeb2 UTSW 2 44996341 missense probably damaging 0.99
R4769:Zeb2 UTSW 2 44996435 missense probably damaging 1.00
R4816:Zeb2 UTSW 2 44997768 missense probably damaging 0.99
R4918:Zeb2 UTSW 2 44996882 missense probably damaging 1.00
R4969:Zeb2 UTSW 2 44998919 missense probably damaging 1.00
R5191:Zeb2 UTSW 2 45002600 missense probably benign 0.00
R5195:Zeb2 UTSW 2 45001635 missense probably damaging 1.00
R5322:Zeb2 UTSW 2 44997095 missense probably damaging 1.00
R5699:Zeb2 UTSW 2 44997788 missense probably damaging 1.00
R5750:Zeb2 UTSW 2 44997518 missense probably damaging 0.96
R5764:Zeb2 UTSW 2 44996919 missense possibly damaging 0.89
R5914:Zeb2 UTSW 2 44997052 missense probably benign 0.00
R5918:Zeb2 UTSW 2 45111259 intron probably benign
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6302:Zeb2 UTSW 2 44997759 missense probably benign 0.18
R6372:Zeb2 UTSW 2 45002539 missense probably damaging 1.00
R6402:Zeb2 UTSW 2 44996975 missense probably damaging 1.00
R6492:Zeb2 UTSW 2 45110496 intron probably benign
R6554:Zeb2 UTSW 2 44997512 missense probably damaging 1.00
R6675:Zeb2 UTSW 2 44997445 nonsense probably null
R6735:Zeb2 UTSW 2 45110016 missense probably null 0.99
R6870:Zeb2 UTSW 2 44988910 missense probably damaging 0.98
R6925:Zeb2 UTSW 2 44994529 missense probably damaging 1.00
R6963:Zeb2 UTSW 2 44988799 missense probably damaging 0.97
R6972:Zeb2 UTSW 2 44997318 missense probably damaging 1.00
R7144:Zeb2 UTSW 2 45110041 missense possibly damaging 0.66
R7178:Zeb2 UTSW 2 44996994 missense probably damaging 0.97
R7419:Zeb2 UTSW 2 44996347 missense probably benign 0.20
R7580:Zeb2 UTSW 2 44994532 missense probably damaging 1.00
R7599:Zeb2 UTSW 2 44994613 missense probably damaging 1.00
R7625:Zeb2 UTSW 2 45002572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCATGAAATTCCATGCCTCTGC -3'
(R):5'- GAGATGGTCAAGGTTTCCCTGTCAC -3'

Sequencing Primer
(F):5'- TTAAGGTAAACACCCAGGCATGTAG -3'
(R):5'- GGTCATCTTCTCTTCTGACTAATGAG -3'
Posted On2014-04-24