Mutagenetix > Incidental Mutations

Incidental Mutation 'R1636:Cftr'

173156

Institutional Source

Beutler Lab

Gene Symbol

Cftr

Ensembl Gene

ENSMUSG00000041301

Gene Name

cystic fibrosis transmembrane conductance regulator

Synonyms

Abcc7

MMRRC Submission

039672-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.188) question?

Stock #

R1636 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

18170687-18322768 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 18226157 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 368 (I368K)

Ref Sequence

ENSEMBL: ENSMUSP00000115334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000129452] [ENSMUST00000140407]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045706
AA Change: I368K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: I368K

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	3.7e-40	PFAM
AAA	450	623	2.16e-12	SMART
Pfam:CFTR_R	639	844	2e-93	PFAM
Pfam:ABC_membrane	857	1142	2.7e-53	PFAM
AAA	1232	1414	9.94e-12	SMART
low complexity region	1465	1474	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115405
AA Change: I368K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301
AA Change: I368K

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.4e-48	PFAM
Pfam:ABC_tran	441	570	2.3e-19	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115406
AA Change: I338K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: I338K

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	167	4e-14	PFAM
Pfam:ABC_membrane	162	320	2.5e-20	PFAM
AAA	420	593	2.16e-12	SMART
Pfam:CFTR_R	609	815	1.3e-97	PFAM
Pfam:ABC_membrane	827	1112	1e-50	PFAM
AAA	1202	1384	9.94e-12	SMART
low complexity region	1435	1444	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000129452
AA Change: I368K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000115334
Gene: ENSMUSG00000041301
AA Change: I368K

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	3.9e-39	PFAM
Pfam:ABC_tran	441	528	5.6e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140407
AA Change: I368K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301
AA Change: I368K

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.2e-48	PFAM
Pfam:ABC_tran	441	568	6.3e-20	PFAM

Meta Mutation Damage Score

0.6763

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.4%
20x: 86.1%

Validation Efficiency

96% (85/89)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Abca7	A	G	10: 80,008,998	H1518R	probably benign	Het
Adam4	A	G	12: 81,419,690	L719S	probably damaging	Het
Adprm	T	C	11: 67,041,723	Y120C	possibly damaging	Het
Arhgap25	T	A	6: 87,495,941	Y78F	probably damaging	Het
Asap1	G	A	15: 64,123,912	P665L	probably damaging	Het
Bank1	T	C	3: 136,083,226	K637R	probably damaging	Het
BC005561	T	A	5: 104,520,750	M1046K	probably damaging	Het
Bcr	T	A	10: 75,131,066	L502M	probably damaging	Het
Brwd1	A	G	16: 96,059,641	L315P	probably damaging	Het
Btbd7	A	T	12: 102,793,851	Y613N	probably damaging	Het
Cdca7l	G	A	12: 117,876,928	R395H	probably damaging	Het
D6Wsu163e	T	C	6: 126,946,601	V150A	possibly damaging	Het
Ddx52	A	G	11: 83,955,343	T470A	probably damaging	Het
Def6	A	G	17: 28,223,918	E316G	possibly damaging	Het
Dip2a	A	T	10: 76,321,578	N64K	probably benign	Het
Dlgap4	G	T	2: 156,746,077	E631*	probably null	Het
Dner	T	C	1: 84,585,330	K190E	possibly damaging	Het
Eif2b4	T	A	5: 31,192,266		probably null	Het
Eif3a	A	T	19: 60,781,905	D119E	possibly damaging	Het
Ercc2	C	T	7: 19,387,124	T276M	possibly damaging	Het
Exoc1	A	G	5: 76,568,118	K830R	probably benign	Het
F2r	G	T	13: 95,603,892	Y378*	probably null	Het
Fam186a	G	A	15: 99,941,658	T2235I	unknown	Het
Fmo3	T	G	1: 162,954,425	K453T	probably benign	Het
Fzd3	A	T	14: 65,253,106	D9E	probably benign	Het
Galns	A	G	8: 122,604,216		probably benign	Het
Gm1818	T	C	12: 48,555,767		noncoding transcript	Het
Gm9955	C	A	18: 24,709,230		probably benign	Het
Immp2l	T	C	12: 41,703,687	V113A	probably damaging	Het
Iyd	T	A	10: 3,545,588	M82K	possibly damaging	Het
Kif21a	A	T	15: 90,984,805		probably benign	Het
Lipf	A	G	19: 33,976,535	D342G	probably damaging	Het
Lmbrd1	C	A	1: 24,746,930	Y435*	probably null	Het
Mpped1	C	T	15: 83,791,990		probably benign	Het
Mtrf1l	A	G	10: 5,813,265	S355P	probably damaging	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Neo1	T	C	9: 58,913,277	S788G	probably damaging	Het
Nfx1	T	G	4: 41,016,072		probably null	Het
Nlrp4c	T	C	7: 6,066,738	V546A	possibly damaging	Het
Nwd2	G	A	5: 63,807,557	V1495M	probably damaging	Het
Oaf	T	A	9: 43,239,324	I84F	probably benign	Het
Obscn	A	G	11: 59,122,637	F1153S	probably damaging	Het
Ofcc1	A	T	13: 40,180,428	C396S	possibly damaging	Het
Olfr576	T	G	7: 102,965,691	I197S	possibly damaging	Het
Olfr955	T	C	9: 39,469,919	D269G	probably benign	Het
Omg	A	G	11: 79,502,340	S231P	probably benign	Het
Pdcl3	A	G	1: 38,994,935	T53A	possibly damaging	Het
Pik3r2	A	T	8: 70,771,898	H244Q	probably benign	Het
Pinx1	A	T	14: 63,866,137	H55L	probably damaging	Het
Pwwp2b	T	A	7: 139,254,842	H66Q	probably benign	Het
Rell2	A	G	18: 37,958,079	D99G	probably damaging	Het
Reln	G	A	5: 21,998,683	A1191V	probably damaging	Het
Rprm	T	C	2: 54,085,304	M1V	probably null	Het
Sav1	A	C	12: 69,984,495	H84Q	probably benign	Het
Scamp5	T	C	9: 57,451,409	D28G	possibly damaging	Het
Selenbp2	G	A	3: 94,696,815	G9D	probably damaging	Het
Sh3tc2	T	C	18: 61,989,721	W518R	probably damaging	Het
Slc10a6	A	T	5: 103,629,146	N29K	probably benign	Het
Spindoc	C	A	19: 7,374,557	D142Y	probably damaging	Het
Spink12	T	A	18: 44,107,728	D60E	probably benign	Het
Sugt1	A	G	14: 79,587,982	I23V	probably benign	Het
Syne2	T	C	12: 76,004,732	C4079R	probably benign	Het
Tex15	T	G	8: 33,576,387	Y1948*	probably null	Het
Tln2	T	C	9: 67,306,532	E321G	probably damaging	Het
Tmem198b	A	G	10: 128,802,196	L166P	probably damaging	Het
Tspear	T	A	10: 77,870,419	L341H	possibly damaging	Het
Ttn	T	A	2: 76,900,222		probably benign	Het
Unc13a	G	A	8: 71,653,390	T690I	probably damaging	Het
Ush2a	T	C	1: 188,466,176	I1479T	possibly damaging	Het
Vcan	G	A	13: 89,703,667	T1058I	possibly damaging	Het
Vmn1r84	T	C	7: 12,362,595	Q45R	probably benign	Het
Vmn2r111	T	C	17: 22,571,399	N209D	probably damaging	Het
Wbp1l	A	G	19: 46,644,444	Y40C	probably damaging	Het
Wdr72	A	T	9: 74,179,625	H625L	probably benign	Het
Zeb2	T	C	2: 45,002,611	Y195C	probably damaging	Het
Zkscan6	C	T	11: 65,814,430		probably benign	Het
Zmym6	C	A	4: 127,123,767	H1022N	probably damaging	Het

Other mutations in Cftr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00901:Cftr	APN	6	18268430	critical splice donor site	probably null
IGL01082:Cftr	APN	6	18226103	missense	probably damaging	0.97
IGL01113:Cftr	APN	6	18270253	missense	probably damaging	1.00
IGL01383:Cftr	APN	6	18226041	missense	probably benign	0.00
IGL01595:Cftr	APN	6	18198239	splice site	probably benign
IGL01820:Cftr	APN	6	18226139	missense	probably damaging	1.00
IGL02223:Cftr	APN	6	18221482	missense	probably damaging	1.00
IGL02249:Cftr	APN	6	18277871	missense	possibly damaging	0.58
IGL02439:Cftr	APN	6	18258238	nonsense	probably null
IGL02537:Cftr	APN	6	18274597	missense	probably benign	0.31
IGL03234:Cftr	APN	6	18225988	missense	probably damaging	0.96
PIT4453001:Cftr	UTSW	6	18214106	missense	probably damaging	0.99
PIT4520001:Cftr	UTSW	6	18277843	missense	probably benign	0.01
R0114:Cftr	UTSW	6	18282448	missense	probably damaging	1.00
R0329:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0330:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0331:Cftr	UTSW	6	18235226	missense	possibly damaging	0.72
R0480:Cftr	UTSW	6	18274518	splice site	probably benign
R0612:Cftr	UTSW	6	18198126	missense	probably benign	0.01
R0633:Cftr	UTSW	6	18305980	missense	probably damaging	0.99
R0830:Cftr	UTSW	6	18270225	missense	probably benign	0.02
R1559:Cftr	UTSW	6	18225937	missense	probably benign	0.01
R1629:Cftr	UTSW	6	18226106	missense	probably damaging	1.00
R1860:Cftr	UTSW	6	18268289	missense	probably benign	0.00
R2043:Cftr	UTSW	6	18320935	missense	probably benign
R2211:Cftr	UTSW	6	18214280	missense	probably null	0.13
R4737:Cftr	UTSW	6	18299883	missense	probably benign	0.19
R4793:Cftr	UTSW	6	18226088	missense	probably damaging	1.00
R4857:Cftr	UTSW	6	18320975	missense	possibly damaging	0.92
R4984:Cftr	UTSW	6	18235199	missense	possibly damaging	0.89
R4999:Cftr	UTSW	6	18221614	missense	probably benign	0.17
R5045:Cftr	UTSW	6	18230081	missense	probably benign	0.20
R5183:Cftr	UTSW	6	18299833	missense	probably damaging	0.99
R5197:Cftr	UTSW	6	18255414	missense	probably benign	0.00
R5288:Cftr	UTSW	6	18226129	nonsense	probably null
R5337:Cftr	UTSW	6	18319059	missense	probably damaging	1.00
R5549:Cftr	UTSW	6	18227954	missense	probably benign	0.00
R5596:Cftr	UTSW	6	18268096	missense	probably benign	0.00
R5651:Cftr	UTSW	6	18255365	splice site	probably null
R5660:Cftr	UTSW	6	18313687	missense	probably benign	0.22
R5941:Cftr	UTSW	6	18313646	missense	probably damaging	1.00
R6221:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6222:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6229:Cftr	UTSW	6	18220684	missense	probably damaging	1.00
R6256:Cftr	UTSW	6	18274661	missense	probably damaging	0.96
R6257:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6412:Cftr	UTSW	6	18285604	missense	probably damaging	0.97
R6459:Cftr	UTSW	6	18258236	missense	probably damaging	1.00
R6558:Cftr	UTSW	6	18222528	missense	probably damaging	1.00
R6724:Cftr	UTSW	6	18255974	nonsense	probably null
R6787:Cftr	UTSW	6	18274608	nonsense	probably null
R6861:Cftr	UTSW	6	18268108	missense	probably benign	0.00
R6888:Cftr	UTSW	6	18313730	critical splice donor site	probably null
R7084:Cftr	UTSW	6	18226138	missense	probably benign	0.17
R7105:Cftr	UTSW	6	18318972	missense	probably damaging	1.00
R7320:Cftr	UTSW	6	18319013	missense	probably damaging	0.97
R7359:Cftr	UTSW	6	18221624	missense	probably benign	0.00
R7466:Cftr	UTSW	6	18227973	missense	probably benign
R7502:Cftr	UTSW	6	18214296	missense	probably damaging	1.00
R7748:Cftr	UTSW	6	18277889	critical splice donor site	probably null
R7808:Cftr	UTSW	6	18204205	missense	probably benign
R7817:Cftr	UTSW	6	18267968	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GGCGGCCTATATGAGGTTCTTCAC -3'
(R):5'- CTGGTCTGCTGGAAGCTGAAGTTC -3'

Sequencing Primer
(F):5'- ATATGAGGTTCTTCACTAGCTCTG -3'
(R):5'- TGGCCTACAAGGTGAGCATTC -3'

Posted On

2014-04-24