Incidental Mutation 'R1636:Olfr955'
ID173171
Institutional Source Beutler Lab
Gene Symbol Olfr955
Ensembl Gene ENSMUSG00000063176
Gene Nameolfactory receptor 955
SynonymsMOR171-50, GA_x6K02T2PVTD-33167297-33166353, MOR171-34
MMRRC Submission 039672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1636 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39465801-39471944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39469919 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 269 (D269G)
Ref Sequence ENSEMBL: ENSMUSP00000151246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073946] [ENSMUST00000220176]
Predicted Effect probably benign
Transcript: ENSMUST00000073946
AA Change: D269G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000073602
Gene: ENSMUSG00000063176
AA Change: D269G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219910
Predicted Effect probably benign
Transcript: ENSMUST00000220176
AA Change: D269G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 96% (85/89)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Abca7 A G 10: 80,008,998 H1518R probably benign Het
Adam4 A G 12: 81,419,690 L719S probably damaging Het
Adprm T C 11: 67,041,723 Y120C possibly damaging Het
Arhgap25 T A 6: 87,495,941 Y78F probably damaging Het
Asap1 G A 15: 64,123,912 P665L probably damaging Het
Bank1 T C 3: 136,083,226 K637R probably damaging Het
BC005561 T A 5: 104,520,750 M1046K probably damaging Het
Bcr T A 10: 75,131,066 L502M probably damaging Het
Brwd1 A G 16: 96,059,641 L315P probably damaging Het
Btbd7 A T 12: 102,793,851 Y613N probably damaging Het
Cdca7l G A 12: 117,876,928 R395H probably damaging Het
Cftr T A 6: 18,226,157 I368K probably damaging Het
D6Wsu163e T C 6: 126,946,601 V150A possibly damaging Het
Ddx52 A G 11: 83,955,343 T470A probably damaging Het
Def6 A G 17: 28,223,918 E316G possibly damaging Het
Dip2a A T 10: 76,321,578 N64K probably benign Het
Dlgap4 G T 2: 156,746,077 E631* probably null Het
Dner T C 1: 84,585,330 K190E possibly damaging Het
Eif2b4 T A 5: 31,192,266 probably null Het
Eif3a A T 19: 60,781,905 D119E possibly damaging Het
Ercc2 C T 7: 19,387,124 T276M possibly damaging Het
Exoc1 A G 5: 76,568,118 K830R probably benign Het
F2r G T 13: 95,603,892 Y378* probably null Het
Fam186a G A 15: 99,941,658 T2235I unknown Het
Fmo3 T G 1: 162,954,425 K453T probably benign Het
Fzd3 A T 14: 65,253,106 D9E probably benign Het
Galns A G 8: 122,604,216 probably benign Het
Gm1818 T C 12: 48,555,767 noncoding transcript Het
Gm9955 C A 18: 24,709,230 probably benign Het
Immp2l T C 12: 41,703,687 V113A probably damaging Het
Iyd T A 10: 3,545,588 M82K possibly damaging Het
Kif21a A T 15: 90,984,805 probably benign Het
Lipf A G 19: 33,976,535 D342G probably damaging Het
Lmbrd1 C A 1: 24,746,930 Y435* probably null Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mtrf1l A G 10: 5,813,265 S355P probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neo1 T C 9: 58,913,277 S788G probably damaging Het
Nfx1 T G 4: 41,016,072 probably null Het
Nlrp4c T C 7: 6,066,738 V546A possibly damaging Het
Nwd2 G A 5: 63,807,557 V1495M probably damaging Het
Oaf T A 9: 43,239,324 I84F probably benign Het
Obscn A G 11: 59,122,637 F1153S probably damaging Het
Ofcc1 A T 13: 40,180,428 C396S possibly damaging Het
Olfr576 T G 7: 102,965,691 I197S possibly damaging Het
Omg A G 11: 79,502,340 S231P probably benign Het
Pdcl3 A G 1: 38,994,935 T53A possibly damaging Het
Pik3r2 A T 8: 70,771,898 H244Q probably benign Het
Pinx1 A T 14: 63,866,137 H55L probably damaging Het
Pwwp2b T A 7: 139,254,842 H66Q probably benign Het
Rell2 A G 18: 37,958,079 D99G probably damaging Het
Reln G A 5: 21,998,683 A1191V probably damaging Het
Rprm T C 2: 54,085,304 M1V probably null Het
Sav1 A C 12: 69,984,495 H84Q probably benign Het
Scamp5 T C 9: 57,451,409 D28G possibly damaging Het
Selenbp2 G A 3: 94,696,815 G9D probably damaging Het
Sh3tc2 T C 18: 61,989,721 W518R probably damaging Het
Slc10a6 A T 5: 103,629,146 N29K probably benign Het
Spindoc C A 19: 7,374,557 D142Y probably damaging Het
Spink12 T A 18: 44,107,728 D60E probably benign Het
Sugt1 A G 14: 79,587,982 I23V probably benign Het
Syne2 T C 12: 76,004,732 C4079R probably benign Het
Tex15 T G 8: 33,576,387 Y1948* probably null Het
Tln2 T C 9: 67,306,532 E321G probably damaging Het
Tmem198b A G 10: 128,802,196 L166P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttn T A 2: 76,900,222 probably benign Het
Unc13a G A 8: 71,653,390 T690I probably damaging Het
Ush2a T C 1: 188,466,176 I1479T possibly damaging Het
Vcan G A 13: 89,703,667 T1058I possibly damaging Het
Vmn1r84 T C 7: 12,362,595 Q45R probably benign Het
Vmn2r111 T C 17: 22,571,399 N209D probably damaging Het
Wbp1l A G 19: 46,644,444 Y40C probably damaging Het
Wdr72 A T 9: 74,179,625 H625L probably benign Het
Zeb2 T C 2: 45,002,611 Y195C probably damaging Het
Zkscan6 C T 11: 65,814,430 probably benign Het
Zmym6 C A 4: 127,123,767 H1022N probably damaging Het
Other mutations in Olfr955
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Olfr955 APN 9 39470243 missense probably benign 0.00
IGL02550:Olfr955 APN 9 39470546 missense probably benign 0.42
IGL02743:Olfr955 APN 9 39470246 missense probably benign 0.10
R0029:Olfr955 UTSW 9 39470660 missense probably benign 0.06
R0329:Olfr955 UTSW 9 39470556 missense possibly damaging 0.52
R0610:Olfr955 UTSW 9 39469823 missense probably damaging 0.98
R1420:Olfr955 UTSW 9 39469993 missense probably damaging 1.00
R1937:Olfr955 UTSW 9 39470037 missense possibly damaging 0.63
R2655:Olfr955 UTSW 9 39470628 missense probably benign
R2944:Olfr955 UTSW 9 39469938 missense possibly damaging 0.52
R3788:Olfr955 UTSW 9 39470069 missense probably benign 0.03
R4829:Olfr955 UTSW 9 39470367 missense probably damaging 0.99
R5625:Olfr955 UTSW 9 39469803 missense probably benign
R6168:Olfr955 UTSW 9 39470657 missense probably damaging 1.00
R6383:Olfr955 UTSW 9 39470630 missense probably damaging 1.00
R6418:Olfr955 UTSW 9 39469816 missense probably benign 0.07
R6645:Olfr955 UTSW 9 39470266 missense probably benign 0.03
R7062:Olfr955 UTSW 9 39470057 missense probably benign
R7765:Olfr955 UTSW 9 39470316 missense probably benign 0.28
R7847:Olfr955 UTSW 9 39470505 missense probably benign 0.42
R8122:Olfr955 UTSW 9 39470526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGATCTGCATCTGAGAATCCTCTTC -3'
(R):5'- AGCCATGACCATCATTGGCTCTTAC -3'

Sequencing Primer
(F):5'- AGACTATATCCTGCTGTACACTG -3'
(R):5'- GGCTCTTACATCTTCATCATTATCAG -3'
Posted On2014-04-24