Incidental Mutation 'R1636:Fam186a'
ID173206
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Namefamily with sequence similarity 186, member A
SynonymsLOC380973, 1700030F18Rik
MMRRC Submission 039672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1636 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99918348-99967061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99941658 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 2235 (T2235I)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
Predicted Effect unknown
Transcript: ENSMUST00000100209
AA Change: T2235I
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: T2235I

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180309
Meta Mutation Damage Score 0.1358 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 96% (85/89)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Abca7 A G 10: 80,008,998 H1518R probably benign Het
Adam4 A G 12: 81,419,690 L719S probably damaging Het
Adprm T C 11: 67,041,723 Y120C possibly damaging Het
Arhgap25 T A 6: 87,495,941 Y78F probably damaging Het
Asap1 G A 15: 64,123,912 P665L probably damaging Het
Bank1 T C 3: 136,083,226 K637R probably damaging Het
BC005561 T A 5: 104,520,750 M1046K probably damaging Het
Bcr T A 10: 75,131,066 L502M probably damaging Het
Brwd1 A G 16: 96,059,641 L315P probably damaging Het
Btbd7 A T 12: 102,793,851 Y613N probably damaging Het
Cdca7l G A 12: 117,876,928 R395H probably damaging Het
Cftr T A 6: 18,226,157 I368K probably damaging Het
D6Wsu163e T C 6: 126,946,601 V150A possibly damaging Het
Ddx52 A G 11: 83,955,343 T470A probably damaging Het
Def6 A G 17: 28,223,918 E316G possibly damaging Het
Dip2a A T 10: 76,321,578 N64K probably benign Het
Dlgap4 G T 2: 156,746,077 E631* probably null Het
Dner T C 1: 84,585,330 K190E possibly damaging Het
Eif2b4 T A 5: 31,192,266 probably null Het
Eif3a A T 19: 60,781,905 D119E possibly damaging Het
Ercc2 C T 7: 19,387,124 T276M possibly damaging Het
Exoc1 A G 5: 76,568,118 K830R probably benign Het
F2r G T 13: 95,603,892 Y378* probably null Het
Fmo3 T G 1: 162,954,425 K453T probably benign Het
Fzd3 A T 14: 65,253,106 D9E probably benign Het
Galns A G 8: 122,604,216 probably benign Het
Gm1818 T C 12: 48,555,767 noncoding transcript Het
Gm9955 C A 18: 24,709,230 probably benign Het
Immp2l T C 12: 41,703,687 V113A probably damaging Het
Iyd T A 10: 3,545,588 M82K possibly damaging Het
Kif21a A T 15: 90,984,805 probably benign Het
Lipf A G 19: 33,976,535 D342G probably damaging Het
Lmbrd1 C A 1: 24,746,930 Y435* probably null Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mtrf1l A G 10: 5,813,265 S355P probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neo1 T C 9: 58,913,277 S788G probably damaging Het
Nfx1 T G 4: 41,016,072 probably null Het
Nlrp4c T C 7: 6,066,738 V546A possibly damaging Het
Nwd2 G A 5: 63,807,557 V1495M probably damaging Het
Oaf T A 9: 43,239,324 I84F probably benign Het
Obscn A G 11: 59,122,637 F1153S probably damaging Het
Ofcc1 A T 13: 40,180,428 C396S possibly damaging Het
Olfr576 T G 7: 102,965,691 I197S possibly damaging Het
Olfr955 T C 9: 39,469,919 D269G probably benign Het
Omg A G 11: 79,502,340 S231P probably benign Het
Pdcl3 A G 1: 38,994,935 T53A possibly damaging Het
Pik3r2 A T 8: 70,771,898 H244Q probably benign Het
Pinx1 A T 14: 63,866,137 H55L probably damaging Het
Pwwp2b T A 7: 139,254,842 H66Q probably benign Het
Rell2 A G 18: 37,958,079 D99G probably damaging Het
Reln G A 5: 21,998,683 A1191V probably damaging Het
Rprm T C 2: 54,085,304 M1V probably null Het
Sav1 A C 12: 69,984,495 H84Q probably benign Het
Scamp5 T C 9: 57,451,409 D28G possibly damaging Het
Selenbp2 G A 3: 94,696,815 G9D probably damaging Het
Sh3tc2 T C 18: 61,989,721 W518R probably damaging Het
Slc10a6 A T 5: 103,629,146 N29K probably benign Het
Spindoc C A 19: 7,374,557 D142Y probably damaging Het
Spink12 T A 18: 44,107,728 D60E probably benign Het
Sugt1 A G 14: 79,587,982 I23V probably benign Het
Syne2 T C 12: 76,004,732 C4079R probably benign Het
Tex15 T G 8: 33,576,387 Y1948* probably null Het
Tln2 T C 9: 67,306,532 E321G probably damaging Het
Tmem198b A G 10: 128,802,196 L166P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttn T A 2: 76,900,222 probably benign Het
Unc13a G A 8: 71,653,390 T690I probably damaging Het
Ush2a T C 1: 188,466,176 I1479T possibly damaging Het
Vcan G A 13: 89,703,667 T1058I possibly damaging Het
Vmn1r84 T C 7: 12,362,595 Q45R probably benign Het
Vmn2r111 T C 17: 22,571,399 N209D probably damaging Het
Wbp1l A G 19: 46,644,444 Y40C probably damaging Het
Wdr72 A T 9: 74,179,625 H625L probably benign Het
Zeb2 T C 2: 45,002,611 Y195C probably damaging Het
Zkscan6 C T 11: 65,814,430 probably benign Het
Zmym6 C A 4: 127,123,767 H1022N probably damaging Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99927691 splice site probably benign
IGL03047:Fam186a UTSW 15 99945708 missense unknown
R0172:Fam186a UTSW 15 99954887 missense unknown
R0194:Fam186a UTSW 15 99941763 missense possibly damaging 0.92
R0381:Fam186a UTSW 15 99942174 missense probably damaging 0.97
R0799:Fam186a UTSW 15 99942012 missense probably damaging 1.00
R1295:Fam186a UTSW 15 99939789 splice site probably benign
R1366:Fam186a UTSW 15 99943389 missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99947655 missense unknown
R1592:Fam186a UTSW 15 99940318 missense probably benign 0.01
R1719:Fam186a UTSW 15 99942346 missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99966881 nonsense probably null
R1856:Fam186a UTSW 15 99940302 missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99933676 unclassified probably benign
R2192:Fam186a UTSW 15 99940311 missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99954864 missense unknown
R2251:Fam186a UTSW 15 99945097 missense probably benign 0.02
R2902:Fam186a UTSW 15 99945168 missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99943794 missense probably damaging 0.99
R3744:Fam186a UTSW 15 99947535 missense unknown
R4021:Fam186a UTSW 15 99941799 missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99933685 unclassified probably benign
R4238:Fam186a UTSW 15 99943642 missense probably benign 0.05
R4667:Fam186a UTSW 15 99944532 missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99933538 unclassified probably benign
R4835:Fam186a UTSW 15 99945808 missense unknown
R4837:Fam186a UTSW 15 99940797 missense unknown
R4897:Fam186a UTSW 15 99945277 missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99946842 missense unknown
R4950:Fam186a UTSW 15 99941653 missense unknown
R4995:Fam186a UTSW 15 99945099 missense probably benign 0.27
R5062:Fam186a UTSW 15 99944646 missense possibly damaging 0.66
R5124:Fam186a UTSW 15 99943096 missense possibly damaging 0.90
R5133:Fam186a UTSW 15 99955493 missense unknown
R5424:Fam186a UTSW 15 99945763 missense unknown
R5624:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99947050 missense unknown
R5652:Fam186a UTSW 15 99945372 missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99966824 nonsense probably null
R5965:Fam186a UTSW 15 99945097 missense probably benign 0.37
R6044:Fam186a UTSW 15 99941997 missense probably damaging 0.97
R6077:Fam186a UTSW 15 99942703 missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99940363 missense probably benign 0.00
R6185:Fam186a UTSW 15 99947649 missense unknown
R6186:Fam186a UTSW 15 99947325 missense unknown
R6242:Fam186a UTSW 15 99939907 missense unknown
R6351:Fam186a UTSW 15 99941742 missense probably damaging 0.97
R6368:Fam186a UTSW 15 99943317 missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99947331 missense unknown
R6559:Fam186a UTSW 15 99944475 missense possibly damaging 0.46
R6855:Fam186a UTSW 15 99954875 missense unknown
R6867:Fam186a UTSW 15 99945850 missense unknown
R6957:Fam186a UTSW 15 99946476 missense unknown
R6961:Fam186a UTSW 15 99940201 missense probably benign 0.16
R6994:Fam186a UTSW 15 99942466 missense probably benign 0.35
R6996:Fam186a UTSW 15 99955493 missense unknown
R7062:Fam186a UTSW 15 99933640 unclassified probably benign
R7064:Fam186a UTSW 15 99941676 missense unknown
R7173:Fam186a UTSW 15 99945650 missense unknown
R7244:Fam186a UTSW 15 99946392 missense unknown
R7270:Fam186a UTSW 15 99944152 missense possibly damaging 0.66
R7410:Fam186a UTSW 15 99946945 nonsense probably null
R7437:Fam186a UTSW 15 99942894 missense probably damaging 1.00
R7475:Fam186a UTSW 15 99947514 missense unknown
R7487:Fam186a UTSW 15 99942136 missense possibly damaging 0.66
R7526:Fam186a UTSW 15 99941915 missense possibly damaging 0.83
R7650:Fam186a UTSW 15 99939907 missense unknown
R7658:Fam186a UTSW 15 99939844 missense unknown
R7663:Fam186a UTSW 15 99945069 missense probably benign 0.00
R7703:Fam186a UTSW 15 99954797 missense unknown
R7814:Fam186a UTSW 15 99944664 missense possibly damaging 0.92
R7958:Fam186a UTSW 15 99943308 missense probably damaging 0.99
R7970:Fam186a UTSW 15 99933586 missense unknown
R8076:Fam186a UTSW 15 99943470 missense possibly damaging 0.83
R8087:Fam186a UTSW 15 99941844 missense possibly damaging 0.46
R8130:Fam186a UTSW 15 99944033 frame shift probably null
R8239:Fam186a UTSW 15 99941310 missense unknown
R8246:Fam186a UTSW 15 99940547 missense unknown
R8446:Fam186a UTSW 15 99947454 missense unknown
R8469:Fam186a UTSW 15 99947305 missense unknown
X0021:Fam186a UTSW 15 99945435 missense probably benign 0.00
Z1088:Fam186a UTSW 15 99945994 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTCCAAATGCCTGGAATGGTTG -3'
(R):5'- AGTTTCCCCACTAAGGAGACCCTG -3'

Sequencing Primer
(F):5'- AATGCCTGGAATGGTTGGGTAG -3'
(R):5'- GGGAGTCATTCTTACTCCTGAACAG -3'
Posted On2014-04-24