Mutagenetix > Incidental Mutations

Incidental Mutation 'R1637:Hjurp'

173219

Institutional Source

Beutler Lab

Gene Symbol

Hjurp

Ensembl Gene

ENSMUSG00000044783

Gene Name

Holliday junction recognition protein

Synonyms

MMRRC Submission

039673-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.887) question?

Stock #

R1637 (G1)

Quality Score

109

Status

Not validated

Chromosome

Chromosomal Location

88262471-88277633 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 88266121 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 279 (S279F)

Ref Sequence

ENSEMBL: ENSMUSP00000070419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]

Predicted Effect

probably benign
Transcript: ENSMUST00000054674
AA Change: S355F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783
AA Change: S355F

Domain	Start	End	E-Value	Type
Pfam:Scm3	11	68	1.5e-10	PFAM
low complexity region	159	175	N/A	INTRINSIC
low complexity region	215	232	N/A	INTRINSIC
Pfam:HJURP_mid	254	370	7.6e-54	PFAM
Pfam:HJURP_C	385	446	3.1e-26	PFAM
low complexity region	496	515	N/A	INTRINSIC
Pfam:HJURP_C	527	585	7.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000061013

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065420
AA Change: S279F

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783
AA Change: S279F

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	2.9e-11	PFAM
low complexity region	83	99	N/A	INTRINSIC
low complexity region	139	156	N/A	INTRINSIC
Pfam:HJURP_mid	178	295	7.4e-64	PFAM
Pfam:HJURP_C	309	371	1.2e-26	PFAM
low complexity region	420	439	N/A	INTRINSIC
Pfam:HJURP_C	451	510	3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113130

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128532

Predicted Effect

probably benign
Transcript: ENSMUST00000147393

SMART Domains

Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	7.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148384

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	A	5: 109,738,992	H50L	probably benign	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Agpat5	A	G	8: 18,881,811	R316G	probably benign	Het
Ankrd39	G	A	1: 36,539,492	Q151*	probably null	Het
Arl13b	T	C	16: 62,830,784	D30G	probably damaging	Het
Atpaf1	A	G	4: 115,788,302	S123G	probably benign	Het
Bicra	A	G	7: 15,972,689	S1276P	probably benign	Het
Car1	T	C	3: 14,777,786	I60V	possibly damaging	Het
Cnbd2	A	G	2: 156,373,724	I411V	probably damaging	Het
Cyp2c37	A	T	19: 40,001,982	K375*	probably null	Het
Cysrt1	T	C	2: 25,239,285	I72V	probably benign	Het
Dock9	T	A	14: 121,651,775	D312V	possibly damaging	Het
Ecd	T	C	14: 20,346,692	I42V	probably damaging	Het
Ercc5	A	G	1: 44,167,534	T536A	probably benign	Het
Gjd2	A	T	2: 114,011,308	Y229*	probably null	Het
Gramd1b	A	T	9: 40,304,538		probably null	Het
Hcrtr2	T	C	9: 76,232,999	T336A	probably benign	Het
Ift140	C	T	17: 25,025,634	L152F	probably benign	Het
Izumo1r	A	G	9: 14,901,809	C56R	probably damaging	Het
Kif7	T	C	7: 79,702,837	E850G	probably damaging	Het
Larp4b	C	G	13: 9,151,097	T335S	probably benign	Het
Lmo7	A	T	14: 101,880,832	R42S	probably damaging	Het
Lrrk2	T	G	15: 91,734,058	L920R	probably benign	Het
Mapk8	G	A	14: 33,410,962	R6C	probably benign	Het
Mpped1	C	T	15: 83,791,990		probably benign	Het
Myoc	A	G	1: 162,639,367	Y35C	probably damaging	Het
Ndufb8	C	T	19: 44,555,035	M66I	probably benign	Het
Nkpd1	T	C	7: 19,523,979	I411T	probably benign	Het
Nrxn3	A	G	12: 89,354,468	N382S	possibly damaging	Het
Olfr1219	A	T	2: 89,075,052	L13Q	probably damaging	Het
Olfr328	A	T	11: 58,551,420	V273E	possibly damaging	Het
Pear1	T	C	3: 87,756,753	E303G	probably damaging	Het
Plekhg4	T	A	8: 105,381,781	M1047K	probably benign	Het
Pofut1	T	G	2: 153,265,789	F268C	probably damaging	Het
Psrc1	G	T	3: 108,385,293	S134I	probably damaging	Het
Slc6a2	A	T	8: 92,981,990	I245F	probably benign	Het
Slc9a1	T	C	4: 133,422,223	S787P	probably benign	Het
Sorcs3	T	A	19: 48,748,359		probably null	Het
Syne2	C	A	12: 75,996,002	H3916N	probably damaging	Het
Taar6	A	G	10: 23,985,181	S156P	probably benign	Het
Tnn	A	G	1: 160,147,600	F86L	probably damaging	Het
Tspear	T	A	10: 77,870,419	L341H	possibly damaging	Het
Ttll8	A	G	15: 88,914,444	V696A	probably benign	Het
Utrn	C	A	10: 12,436,364	D616Y	probably damaging	Het
Vmn2r18	A	T	5: 151,584,757	C301S	probably damaging	Het
Xdh	T	C	17: 73,900,578	Y928C	probably benign	Het
Zfand1	G	A	3: 10,345,982	A104V	probably benign	Het

Other mutations in Hjurp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Hjurp	APN	1	88270269	missense	probably benign	0.04
IGL03099:Hjurp	APN	1	88266289	missense	probably benign	0.09
BB003:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
IGL03097:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03098:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03147:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
PIT4131001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
PIT4142001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
PIT4378001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
PIT4812001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R0053:Hjurp	UTSW	1	88277215	splice site	probably benign
R0371:Hjurp	UTSW	1	88277368	splice site	probably benign
R0442:Hjurp	UTSW	1	88266524	nonsense	probably null
R0762:Hjurp	UTSW	1	88277215	splice site	probably benign
R0928:Hjurp	UTSW	1	88266524	nonsense	probably null
R1333:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
R1342:Hjurp	UTSW	1	88277368	splice site	probably benign
R1364:Hjurp	UTSW	1	88266525	frame shift	probably null
R1496:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R1905:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
R1965:Hjurp	UTSW	1	88266524	nonsense	probably null
R1992:Hjurp	UTSW	1	88266524	nonsense	probably null
R2002:Hjurp	UTSW	1	88266524	nonsense	probably null
R2023:Hjurp	UTSW	1	88266524	nonsense	probably null
R2024:Hjurp	UTSW	1	88266524	nonsense	probably null
R2332:Hjurp	UTSW	1	88277215	splice site	probably benign
R2420:Hjurp	UTSW	1	88266524	nonsense	probably null
R2422:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R2869:Hjurp	UTSW	1	88266524	nonsense	probably null
R2870:Hjurp	UTSW	1	88266524	nonsense	probably null
R2871:Hjurp	UTSW	1	88266524	nonsense	probably null
R2872:Hjurp	UTSW	1	88266524	nonsense	probably null
R3019:Hjurp	UTSW	1	88266524	nonsense	probably null
R3021:Hjurp	UTSW	1	88266524	nonsense	probably null
R3150:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R3411:Hjurp	UTSW	1	88266524	nonsense	probably null
R3552:Hjurp	UTSW	1	88266524	nonsense	probably null
R3704:Hjurp	UTSW	1	88277215	splice site	probably benign
R3730:Hjurp	UTSW	1	88266524	nonsense	probably null
R3733:Hjurp	UTSW	1	88266524	nonsense	probably null
R3764:Hjurp	UTSW	1	88266524	nonsense	probably null
R3799:Hjurp	UTSW	1	88277215	splice site	probably benign
R3819:Hjurp	UTSW	1	88277215	splice site	probably benign
R3857:Hjurp	UTSW	1	88266524	nonsense	probably null
R3930:Hjurp	UTSW	1	88266524	nonsense	probably null
R3952:Hjurp	UTSW	1	88277215	splice site	probably benign
R4090:Hjurp	UTSW	1	88277215	splice site	probably benign
R4159:Hjurp	UTSW	1	88277215	splice site	probably benign
R4207:Hjurp	UTSW	1	88277215	splice site	probably benign
R4322:Hjurp	UTSW	1	88277215	splice site	probably benign
R4391:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4392:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4397:Hjurp	UTSW	1	88266524	nonsense	probably null
R4700:Hjurp	UTSW	1	88266524	nonsense	probably null
R4808:Hjurp	UTSW	1	88277215	splice site	probably benign
R4900:Hjurp	UTSW	1	88266524	nonsense	probably null
R4901:Hjurp	UTSW	1	88266524	nonsense	probably null
R5023:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5024:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5076:Hjurp	UTSW	1	88266524	nonsense	probably null
R5123:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5236:Hjurp	UTSW	1	88266524	nonsense	probably null
R5300:Hjurp	UTSW	1	88266524	nonsense	probably null
R5318:Hjurp	UTSW	1	88266524	nonsense	probably null
R5370:Hjurp	UTSW	1	88266524	nonsense	probably null
R5410:Hjurp	UTSW	1	88266524	nonsense	probably null
R5445:Hjurp	UTSW	1	88266316	missense	probably benign	0.43
R5457:Hjurp	UTSW	1	88266525	frame shift	probably null
R5497:Hjurp	UTSW	1	88266320	missense	possibly damaging	0.92
R5560:Hjurp	UTSW	1	88266524	nonsense	probably null
R5561:Hjurp	UTSW	1	88266524	nonsense	probably null
R5615:Hjurp	UTSW	1	88266524	nonsense	probably null
R5661:Hjurp	UTSW	1	88277215	splice site	probably benign
R5722:Hjurp	UTSW	1	88266524	nonsense	probably null
R6087:Hjurp	UTSW	1	88266524	nonsense	probably null
R6089:Hjurp	UTSW	1	88266524	nonsense	probably null
R6090:Hjurp	UTSW	1	88266524	nonsense	probably null
R6125:Hjurp	UTSW	1	88266524	nonsense	probably null
R6175:Hjurp	UTSW	1	88266524	nonsense	probably null
R6362:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R6659:Hjurp	UTSW	1	88266524	nonsense	probably null
R7016:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7016:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7045:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7179:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7200:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7463:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7912:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R8215:Hjurp	UTSW	1	88266524	nonsense	probably null
R8262:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
V5622:Hjurp	UTSW	1	88277525	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- ACATCGACAGCCCAAGACTCTGTG -3'
(R):5'- GCTCAAAGCCATCCTGCATCATCTC -3'

Sequencing Primer
(F):5'- AGGCTGTTTCCCAGAAGAC -3'
(R):5'- TCAACCAGAGCTGGAAGC -3'

Posted On

2014-04-24