Incidental Mutation 'R1637:Cnbd2'
ID173226
Institutional Source Beutler Lab
Gene Symbol Cnbd2
Ensembl Gene ENSMUSG00000038085
Gene Namecyclic nucleotide binding domain containing 2
Synonyms
MMRRC Submission 039673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1637 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156312299-156375638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156373724 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 411 (I411V)
Ref Sequence ENSEMBL: ENSMUSP00000105208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037096] [ENSMUST00000109580]
Predicted Effect probably damaging
Transcript: ENSMUST00000037096
AA Change: I540V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041268
Gene: ENSMUSG00000038085
AA Change: I540V

DomainStartEndE-ValueType
low complexity region 45 68 N/A INTRINSIC
cNMP 206 332 1.78e-7 SMART
Blast:cNMP 376 443 4e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109580
AA Change: I411V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105208
Gene: ENSMUSG00000038085
AA Change: I411V

DomainStartEndE-ValueType
cNMP 77 203 1.78e-7 SMART
Blast:cNMP 247 314 3e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133751
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility associated with impaired spermiogenesis and development of flagellum bending. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,738,992 H50L probably benign Het
A2m C A 6: 121,654,612 L623M probably benign Het
Agpat5 A G 8: 18,881,811 R316G probably benign Het
Ankrd39 G A 1: 36,539,492 Q151* probably null Het
Arl13b T C 16: 62,830,784 D30G probably damaging Het
Atpaf1 A G 4: 115,788,302 S123G probably benign Het
Bicra A G 7: 15,972,689 S1276P probably benign Het
Car1 T C 3: 14,777,786 I60V possibly damaging Het
Cyp2c37 A T 19: 40,001,982 K375* probably null Het
Cysrt1 T C 2: 25,239,285 I72V probably benign Het
Dock9 T A 14: 121,651,775 D312V possibly damaging Het
Ecd T C 14: 20,346,692 I42V probably damaging Het
Ercc5 A G 1: 44,167,534 T536A probably benign Het
Gjd2 A T 2: 114,011,308 Y229* probably null Het
Gramd1b A T 9: 40,304,538 probably null Het
Hcrtr2 T C 9: 76,232,999 T336A probably benign Het
Hjurp G A 1: 88,266,121 S279F probably benign Het
Ift140 C T 17: 25,025,634 L152F probably benign Het
Izumo1r A G 9: 14,901,809 C56R probably damaging Het
Kif7 T C 7: 79,702,837 E850G probably damaging Het
Larp4b C G 13: 9,151,097 T335S probably benign Het
Lmo7 A T 14: 101,880,832 R42S probably damaging Het
Lrrk2 T G 15: 91,734,058 L920R probably benign Het
Mapk8 G A 14: 33,410,962 R6C probably benign Het
Mpped1 C T 15: 83,791,990 probably benign Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ndufb8 C T 19: 44,555,035 M66I probably benign Het
Nkpd1 T C 7: 19,523,979 I411T probably benign Het
Nrxn3 A G 12: 89,354,468 N382S possibly damaging Het
Olfr1219 A T 2: 89,075,052 L13Q probably damaging Het
Olfr328 A T 11: 58,551,420 V273E possibly damaging Het
Pear1 T C 3: 87,756,753 E303G probably damaging Het
Plekhg4 T A 8: 105,381,781 M1047K probably benign Het
Pofut1 T G 2: 153,265,789 F268C probably damaging Het
Psrc1 G T 3: 108,385,293 S134I probably damaging Het
Slc6a2 A T 8: 92,981,990 I245F probably benign Het
Slc9a1 T C 4: 133,422,223 S787P probably benign Het
Sorcs3 T A 19: 48,748,359 probably null Het
Syne2 C A 12: 75,996,002 H3916N probably damaging Het
Taar6 A G 10: 23,985,181 S156P probably benign Het
Tnn A G 1: 160,147,600 F86L probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttll8 A G 15: 88,914,444 V696A probably benign Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r18 A T 5: 151,584,757 C301S probably damaging Het
Xdh T C 17: 73,900,578 Y928C probably benign Het
Zfand1 G A 3: 10,345,982 A104V probably benign Het
Other mutations in Cnbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Cnbd2 APN 2 156312614 unclassified probably benign
IGL01472:Cnbd2 APN 2 156375348 missense probably damaging 1.00
IGL01738:Cnbd2 APN 2 156375617 utr 3 prime probably benign
IGL01825:Cnbd2 APN 2 156338709 missense probably damaging 1.00
IGL03001:Cnbd2 APN 2 156333634 critical splice donor site probably null
IGL03057:Cnbd2 APN 2 156367672 missense possibly damaging 0.80
R1006:Cnbd2 UTSW 2 156328408 missense possibly damaging 0.86
R1080:Cnbd2 UTSW 2 156339273 missense probably benign 0.28
R1428:Cnbd2 UTSW 2 156339284 critical splice donor site probably null
R1592:Cnbd2 UTSW 2 156335402 missense probably benign 0.30
R1601:Cnbd2 UTSW 2 156333631 missense probably damaging 0.98
R2259:Cnbd2 UTSW 2 156335272 missense probably damaging 1.00
R2352:Cnbd2 UTSW 2 156335355 missense probably damaging 1.00
R4106:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R4109:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R4479:Cnbd2 UTSW 2 156333653 intron probably benign
R4857:Cnbd2 UTSW 2 156367565 missense probably benign 0.01
R4893:Cnbd2 UTSW 2 156365184 missense probably damaging 0.97
R4899:Cnbd2 UTSW 2 156339221 missense probably benign 0.00
R5070:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R5446:Cnbd2 UTSW 2 156367661 missense possibly damaging 0.95
R5784:Cnbd2 UTSW 2 156338657 missense probably damaging 1.00
R6197:Cnbd2 UTSW 2 156375574 missense possibly damaging 0.86
R7009:Cnbd2 UTSW 2 156320034 missense probably benign 0.00
R7221:Cnbd2 UTSW 2 156373661 missense probably benign 0.01
R7577:Cnbd2 UTSW 2 156328376 missense possibly damaging 0.93
X0002:Cnbd2 UTSW 2 156338697 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AAGATGACCTTGGACCCAGGCAAC -3'
(R):5'- CCTGGCTGATGGGAAGCCTTATTC -3'

Sequencing Primer
(F):5'- ATACCAATGTGAGCGGCTCC -3'
(R):5'- ATGGGAAGCCTTATTCAGTGG -3'
Posted On2014-04-24