Incidental Mutation 'R1637:Atpaf1'
ID173235
Institutional Source Beutler Lab
Gene Symbol Atpaf1
Ensembl Gene ENSMUSG00000028710
Gene NameATP synthase mitochondrial F1 complex assembly factor 1
Synonyms6330547J17Rik, ATP11p, ATP11
MMRRC Submission 039673-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R1637 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location115784812-115818828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115788302 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 123 (S123G)
Ref Sequence ENSEMBL: ENSMUSP00000135214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175725] [ENSMUST00000176047] [ENSMUST00000176192] [ENSMUST00000177280]
Predicted Effect probably benign
Transcript: ENSMUST00000175725
SMART Domains Protein: ENSMUSP00000135073
Gene: ENSMUSG00000028710

DomainStartEndE-ValueType
Pfam:ATP11 1 189 2.5e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176047
AA Change: S123G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135831
Gene: ENSMUSG00000028710
AA Change: S123G

DomainStartEndE-ValueType
low complexity region 9 39 N/A INTRINSIC
Pfam:ATP11 91 329 2.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176192
Predicted Effect probably benign
Transcript: ENSMUST00000177280
AA Change: S123G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135214
Gene: ENSMUSG00000028710
AA Change: S123G

DomainStartEndE-ValueType
low complexity region 9 39 N/A INTRINSIC
Pfam:ATP11 89 212 7.3e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000184179
AA Change: S45G
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an assembly factor for the F(1) component of the mitochondrial ATP synthase. This protein binds specifically to the F1 beta subunit and is thought to prevent this subunit from forming nonproductive homooligomers during enzyme assembly. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,738,992 H50L probably benign Het
A2m C A 6: 121,654,612 L623M probably benign Het
Agpat5 A G 8: 18,881,811 R316G probably benign Het
Ankrd39 G A 1: 36,539,492 Q151* probably null Het
Arl13b T C 16: 62,830,784 D30G probably damaging Het
Bicra A G 7: 15,972,689 S1276P probably benign Het
Car1 T C 3: 14,777,786 I60V possibly damaging Het
Cnbd2 A G 2: 156,373,724 I411V probably damaging Het
Cyp2c37 A T 19: 40,001,982 K375* probably null Het
Cysrt1 T C 2: 25,239,285 I72V probably benign Het
Dock9 T A 14: 121,651,775 D312V possibly damaging Het
Ecd T C 14: 20,346,692 I42V probably damaging Het
Ercc5 A G 1: 44,167,534 T536A probably benign Het
Gjd2 A T 2: 114,011,308 Y229* probably null Het
Gramd1b A T 9: 40,304,538 probably null Het
Hcrtr2 T C 9: 76,232,999 T336A probably benign Het
Hjurp G A 1: 88,266,121 S279F probably benign Het
Ift140 C T 17: 25,025,634 L152F probably benign Het
Izumo1r A G 9: 14,901,809 C56R probably damaging Het
Kif7 T C 7: 79,702,837 E850G probably damaging Het
Larp4b C G 13: 9,151,097 T335S probably benign Het
Lmo7 A T 14: 101,880,832 R42S probably damaging Het
Lrrk2 T G 15: 91,734,058 L920R probably benign Het
Mapk8 G A 14: 33,410,962 R6C probably benign Het
Mpped1 C T 15: 83,791,990 probably benign Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ndufb8 C T 19: 44,555,035 M66I probably benign Het
Nkpd1 T C 7: 19,523,979 I411T probably benign Het
Nrxn3 A G 12: 89,354,468 N382S possibly damaging Het
Olfr1219 A T 2: 89,075,052 L13Q probably damaging Het
Olfr328 A T 11: 58,551,420 V273E possibly damaging Het
Pear1 T C 3: 87,756,753 E303G probably damaging Het
Plekhg4 T A 8: 105,381,781 M1047K probably benign Het
Pofut1 T G 2: 153,265,789 F268C probably damaging Het
Psrc1 G T 3: 108,385,293 S134I probably damaging Het
Slc6a2 A T 8: 92,981,990 I245F probably benign Het
Slc9a1 T C 4: 133,422,223 S787P probably benign Het
Sorcs3 T A 19: 48,748,359 probably null Het
Syne2 C A 12: 75,996,002 H3916N probably damaging Het
Taar6 A G 10: 23,985,181 S156P probably benign Het
Tnn A G 1: 160,147,600 F86L probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttll8 A G 15: 88,914,444 V696A probably benign Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r18 A T 5: 151,584,757 C301S probably damaging Het
Xdh T C 17: 73,900,578 Y928C probably benign Het
Zfand1 G A 3: 10,345,982 A104V probably benign Het
Other mutations in Atpaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02529:Atpaf1 APN 4 115791269 missense probably damaging 1.00
IGL03122:Atpaf1 APN 4 115791278 missense probably damaging 1.00
R0396:Atpaf1 UTSW 4 115785252 missense possibly damaging 0.58
R0924:Atpaf1 UTSW 4 115795438 missense probably damaging 1.00
R1462:Atpaf1 UTSW 4 115784953 unclassified probably benign
R1614:Atpaf1 UTSW 4 115796757 missense possibly damaging 0.52
R2180:Atpaf1 UTSW 4 115788360 start codon destroyed probably null 0.03
R4290:Atpaf1 UTSW 4 115788359 missense probably benign 0.02
R4293:Atpaf1 UTSW 4 115788359 missense probably benign 0.02
R7291:Atpaf1 UTSW 4 115811091 missense probably damaging 1.00
R7423:Atpaf1 UTSW 4 115790630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTGCACTGCTGATCCCTAGAG -3'
(R):5'- GCAGGGTACACATTTACTGACGGAG -3'

Sequencing Primer
(F):5'- CCTAGAGGCTTACCTATAGCTGAG -3'
(R):5'- TACACATTTACTGACGGAGAATGAG -3'
Posted On2014-04-24