Incidental Mutation 'R1637:Nkpd1'
ID173243
Institutional Source Beutler Lab
Gene Symbol Nkpd1
Ensembl Gene ENSMUSG00000060621
Gene NameNTPase, KAP family P-loop domain containing 1
Synonyms
MMRRC Submission 039673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1637 (G1)
Quality Score202
Status Not validated
Chromosome7
Chromosomal Location19517838-19525056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19523979 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 411 (I411T)
Ref Sequence ENSEMBL: ENSMUSP00000151162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078908] [ENSMUST00000207576] [ENSMUST00000214205]
Predicted Effect probably benign
Transcript: ENSMUST00000078908
AA Change: I561T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077943
Gene: ENSMUSG00000060621
AA Change: I561T

DomainStartEndE-ValueType
low complexity region 71 103 N/A INTRINSIC
low complexity region 129 158 N/A INTRINSIC
Pfam:KAP_NTPase 186 642 5.7e-29 PFAM
low complexity region 771 780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207576
AA Change: I561T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000214205
AA Change: I411T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,738,992 H50L probably benign Het
A2m C A 6: 121,654,612 L623M probably benign Het
Agpat5 A G 8: 18,881,811 R316G probably benign Het
Ankrd39 G A 1: 36,539,492 Q151* probably null Het
Arl13b T C 16: 62,830,784 D30G probably damaging Het
Atpaf1 A G 4: 115,788,302 S123G probably benign Het
Bicra A G 7: 15,972,689 S1276P probably benign Het
Car1 T C 3: 14,777,786 I60V possibly damaging Het
Cnbd2 A G 2: 156,373,724 I411V probably damaging Het
Cyp2c37 A T 19: 40,001,982 K375* probably null Het
Cysrt1 T C 2: 25,239,285 I72V probably benign Het
Dock9 T A 14: 121,651,775 D312V possibly damaging Het
Ecd T C 14: 20,346,692 I42V probably damaging Het
Ercc5 A G 1: 44,167,534 T536A probably benign Het
Gjd2 A T 2: 114,011,308 Y229* probably null Het
Gramd1b A T 9: 40,304,538 probably null Het
Hcrtr2 T C 9: 76,232,999 T336A probably benign Het
Hjurp G A 1: 88,266,121 S279F probably benign Het
Ift140 C T 17: 25,025,634 L152F probably benign Het
Izumo1r A G 9: 14,901,809 C56R probably damaging Het
Kif7 T C 7: 79,702,837 E850G probably damaging Het
Larp4b C G 13: 9,151,097 T335S probably benign Het
Lmo7 A T 14: 101,880,832 R42S probably damaging Het
Lrrk2 T G 15: 91,734,058 L920R probably benign Het
Mapk8 G A 14: 33,410,962 R6C probably benign Het
Mpped1 C T 15: 83,791,990 probably benign Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ndufb8 C T 19: 44,555,035 M66I probably benign Het
Nrxn3 A G 12: 89,354,468 N382S possibly damaging Het
Olfr1219 A T 2: 89,075,052 L13Q probably damaging Het
Olfr328 A T 11: 58,551,420 V273E possibly damaging Het
Pear1 T C 3: 87,756,753 E303G probably damaging Het
Plekhg4 T A 8: 105,381,781 M1047K probably benign Het
Pofut1 T G 2: 153,265,789 F268C probably damaging Het
Psrc1 G T 3: 108,385,293 S134I probably damaging Het
Slc6a2 A T 8: 92,981,990 I245F probably benign Het
Slc9a1 T C 4: 133,422,223 S787P probably benign Het
Sorcs3 T A 19: 48,748,359 probably null Het
Syne2 C A 12: 75,996,002 H3916N probably damaging Het
Taar6 A G 10: 23,985,181 S156P probably benign Het
Tnn A G 1: 160,147,600 F86L probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttll8 A G 15: 88,914,444 V696A probably benign Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r18 A T 5: 151,584,757 C301S probably damaging Het
Xdh T C 17: 73,900,578 Y928C probably benign Het
Zfand1 G A 3: 10,345,982 A104V probably benign Het
Other mutations in Nkpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nkpd1 APN 7 19518749 missense possibly damaging 0.71
IGL01140:Nkpd1 APN 7 19523462 missense possibly damaging 0.72
IGL01450:Nkpd1 APN 7 19523625 missense probably damaging 1.00
R0003:Nkpd1 UTSW 7 19519927 missense probably benign
R0626:Nkpd1 UTSW 7 19523174 missense probably benign 0.02
R1171:Nkpd1 UTSW 7 19524087 missense possibly damaging 0.94
R1722:Nkpd1 UTSW 7 19523921 missense possibly damaging 0.84
R1823:Nkpd1 UTSW 7 19523252 missense probably damaging 1.00
R2141:Nkpd1 UTSW 7 19524237 missense probably damaging 0.99
R2224:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2225:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2226:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2274:Nkpd1 UTSW 7 19523897 missense probably benign 0.01
R2275:Nkpd1 UTSW 7 19523897 missense probably benign 0.01
R2374:Nkpd1 UTSW 7 19523975 missense possibly damaging 0.50
R3108:Nkpd1 UTSW 7 19522978 missense probably damaging 0.98
R4940:Nkpd1 UTSW 7 19523573 nonsense probably null
R5182:Nkpd1 UTSW 7 19523256 missense probably damaging 1.00
R5362:Nkpd1 UTSW 7 19523268 missense probably damaging 1.00
R5458:Nkpd1 UTSW 7 19524276 missense probably damaging 1.00
R5681:Nkpd1 UTSW 7 19523573 nonsense probably null
R5684:Nkpd1 UTSW 7 19523573 nonsense probably null
R5685:Nkpd1 UTSW 7 19523573 nonsense probably null
R6177:Nkpd1 UTSW 7 19523084 missense probably damaging 1.00
R6200:Nkpd1 UTSW 7 19524603 missense possibly damaging 0.55
R7348:Nkpd1 UTSW 7 19524416 missense probably damaging 0.99
R7356:Nkpd1 UTSW 7 19523774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCATCTTCATCCTGGTGGTGGAC -3'
(R):5'- GGGCACGTACTCATACAGGCAATC -3'

Sequencing Primer
(F):5'- TGGTGGACCCCAGCATTC -3'
(R):5'- ATCACCCTCGTCATGCAGG -3'
Posted On2014-04-24